Incidental Mutation 'R3893:Slc11a1'
ID310021
Institutional Source Beutler Lab
Gene Symbol Slc11a1
Ensembl Gene ENSMUSG00000026177
Gene Namesolute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonymshost resistance locus Bcg/Ity/Lsh, Nramp, ity, Lsh, Ity, Bcg, Nramp1
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3893 (G1)
Quality Score167
Status Validated
Chromosome1
Chromosomal Location74375195-74386062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74384706 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 398 (A398T)
Ref Sequence ENSEMBL: ENSMUSP00000139455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027368] [ENSMUST00000187516]
Predicted Effect probably damaging
Transcript: ENSMUST00000027368
AA Change: A439T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027368
Gene: ENSMUSG00000026177
AA Change: A439T

DomainStartEndE-ValueType
Pfam:Nramp 75 460 1.5e-119 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155865
Predicted Effect probably damaging
Transcript: ENSMUST00000187516
AA Change: A398T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139455
Gene: ENSMUSG00000026177
AA Change: A398T

DomainStartEndE-ValueType
Pfam:Nramp 46 419 1.4e-109 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Meta Mutation Damage Score 0.3007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene are associated with susceptibility to infection with pathogens, including Myobacterium, Salmonella and Leishmania. Depending on the mutation, mutants may exhibit either increased or decreased susceptibility to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Slc11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Slc11a1 APN 1 74381898 splice site probably null
IGL00813:Slc11a1 APN 1 74383480 missense probably benign 0.03
IGL00970:Slc11a1 APN 1 74380662 missense probably damaging 1.00
IGL01017:Slc11a1 APN 1 74379796 missense probably damaging 1.00
IGL01646:Slc11a1 APN 1 74384740 missense probably damaging 0.99
IGL01941:Slc11a1 APN 1 74377179 missense probably damaging 1.00
IGL01996:Slc11a1 APN 1 74376806 missense possibly damaging 0.93
IGL02580:Slc11a1 APN 1 74380259 missense probably damaging 0.99
IGL02586:Slc11a1 APN 1 74385132 splice site probably benign
IGL02961:Slc11a1 APN 1 74377173 missense probably damaging 1.00
R1813:Slc11a1 UTSW 1 74375772 missense probably benign
R1896:Slc11a1 UTSW 1 74375772 missense probably benign
R2219:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2220:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2416:Slc11a1 UTSW 1 74383644 missense probably damaging 0.96
R2432:Slc11a1 UTSW 1 74383751 splice site probably benign
R4450:Slc11a1 UTSW 1 74385535 utr 3 prime probably benign
R4638:Slc11a1 UTSW 1 74375278 start gained probably benign
R4782:Slc11a1 UTSW 1 74384088 missense probably damaging 0.98
R5068:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5069:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5070:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5215:Slc11a1 UTSW 1 74383777 intron probably benign
R5333:Slc11a1 UTSW 1 74384145 missense probably damaging 1.00
R5613:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5621:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5622:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5950:Slc11a1 UTSW 1 74377176 missense probably benign 0.40
R6239:Slc11a1 UTSW 1 74384115 missense possibly damaging 0.82
R6776:Slc11a1 UTSW 1 74384085 missense probably damaging 1.00
R7199:Slc11a1 UTSW 1 74383671 missense possibly damaging 0.83
R7356:Slc11a1 UTSW 1 74385489 missense probably benign
R8142:Slc11a1 UTSW 1 74385259 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCTCAGGGCTCTTTTG -3'
(R):5'- TCCATCACTGACTTGGCAAGG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- CCATACTTAGTAGCTGTGTGACAC -3'
Posted On2015-04-17