Incidental Mutation 'R3893:Prkcq'
ID310023
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Nameprotein kinase C, theta
SynonymsPKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq
MMRRC Submission 040805-MU
Accession Numbers

Genbank: NM_008859; MGI: 97601

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3893 (G1)
Quality Score133
Status Validated
Chromosome2
Chromosomal Location11172108-11301222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11226971 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 35 (E35A)
Ref Sequence ENSEMBL: ENSMUSP00000028118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
PDB Structure
Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028118
AA Change: E35A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: E35A

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102970
AA Change: E35A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: E35A

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114853
SMART Domains Protein: ENSMUSP00000110503
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 9e-86 PDB
Blast:C2 6 101 2e-44 BLAST
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase 380 465 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Meta Mutation Damage Score 0.8098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11283843 missense probably damaging 1.00
IGL01656:Prkcq APN 2 11226955 missense probably damaging 1.00
IGL01732:Prkcq APN 2 11260833 splice site probably benign
IGL02136:Prkcq APN 2 11260668 missense probably benign 0.00
IGL02161:Prkcq APN 2 11277076 missense probably benign
IGL02178:Prkcq APN 2 11277040 missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11260786 missense probably damaging 1.00
IGL03149:Prkcq APN 2 11232545 missense probably benign 0.11
banks UTSW 2 11299410 missense probably damaging 1.00
celina UTSW 2 11283849 missense possibly damaging 0.82
celina2 UTSW 2 11226986 critical splice donor site probably null
Megabytes UTSW 2 11290451 nonsense probably null
3-1:Prkcq UTSW 2 11300094 missense probably damaging 1.00
K3955:Prkcq UTSW 2 11246793 splice site probably benign
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0183:Prkcq UTSW 2 11253162 missense probably damaging 1.00
R0366:Prkcq UTSW 2 11246838 splice site probably benign
R0388:Prkcq UTSW 2 11254234 missense probably benign
R1385:Prkcq UTSW 2 11256286 missense probably damaging 1.00
R1687:Prkcq UTSW 2 11290533 missense probably damaging 1.00
R1693:Prkcq UTSW 2 11254199 missense probably damaging 0.99
R1760:Prkcq UTSW 2 11300070 missense probably damaging 1.00
R1764:Prkcq UTSW 2 11232631 missense probably damaging 1.00
R1968:Prkcq UTSW 2 11245397 missense probably damaging 1.00
R2020:Prkcq UTSW 2 11279521 missense probably benign
R2108:Prkcq UTSW 2 11232569 missense probably damaging 1.00
R2762:Prkcq UTSW 2 11232640 missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11283849 missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11246970 missense probably damaging 1.00
R3545:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3547:Prkcq UTSW 2 11283816 missense probably benign 0.11
R4086:Prkcq UTSW 2 11283868 missense probably damaging 0.97
R4423:Prkcq UTSW 2 11256169 missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11283812 missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11226986 critical splice donor site probably null
R5197:Prkcq UTSW 2 11299416 missense probably damaging 1.00
R6008:Prkcq UTSW 2 11256286 missense probably damaging 1.00
R7030:Prkcq UTSW 2 11226850 splice site probably null
R7231:Prkcq UTSW 2 11290451 nonsense probably null
R7461:Prkcq UTSW 2 11299410 missense probably damaging 1.00
R7613:Prkcq UTSW 2 11299410 missense probably damaging 1.00
R8441:Prkcq UTSW 2 11248226 missense probably benign 0.11
Z1177:Prkcq UTSW 2 11299381 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGTCTGAGATAAAACACTAAGTG -3'
(R):5'- AGGCCATCACTAAGCCTGAG -3'

Sequencing Primer
(F):5'- CTGAGATAAAACACTAAGTGGAGGTG -3'
(R):5'- TTGTCTAGTCTAGCCACC -3'
Posted On2015-04-17