Mutagenetix > Incidental Mutation

Incidental Mutation 'R3893:Zc3h6'

310025

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

040805-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R3893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129016140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 697 (Y697C)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000110320
AA Change: Y697C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y697C

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135186

Meta Mutation Damage Score

0.1807

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (42/42)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	A	1: 37,631,458	M134L	probably benign	Het
2610303G11Rik	A	T	9: 98,186,811		noncoding transcript	Het
Adam19	C	T	11: 46,128,838	A455V	probably damaging	Het
Akr1c19	G	A	13: 4,238,442	D140N	probably damaging	Het
Atoh1	A	G	6: 64,730,133	T271A	probably damaging	Het
Atp6v0a2	G	A	5: 124,639,265	R168Q	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cadps	A	G	14: 12,488,883		probably benign	Het
Cfap69	A	T	5: 5,581,245	V61E	probably damaging	Het
Chd5	A	G	4: 152,360,656	R365G	probably damaging	Het
Dnajc18	A	T	18: 35,700,995		probably null	Het
Fam49a	T	C	12: 12,362,525	V232A	probably benign	Het
Fmnl1	T	A	11: 103,196,757		probably benign	Het
Gca	A	G	2: 62,679,220	Y89C	probably damaging	Het
Gcnt2	A	G	13: 40,860,446	Y31C	probably benign	Het
Gem	C	T	4: 11,705,889		probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
Gprin3	T	C	6: 59,354,479	Y281C	probably benign	Het
H2-M11	A	G	17: 36,547,090	T6A	probably benign	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lrrk1	T	C	7: 66,278,520		probably benign	Het
Macf1	A	G	4: 123,486,406	Y1298H	probably damaging	Het
Micu3	C	T	8: 40,366,224	L315F	probably damaging	Het
Pkd1	G	A	17: 24,572,110		probably null	Het
Pkhd1	A	T	1: 20,312,138	Y2596*	probably null	Het
Pnliprp2	A	G	19: 58,766,273	S250G	probably benign	Het
Prkcq	A	C	2: 11,226,971	E35A	probably damaging	Het
Prpf8	C	A	11: 75,500,257	S1377R	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rsbn1l	C	T	5: 20,905,840	R500H	probably damaging	Het
Sart3	C	T	5: 113,746,636	E636K	probably benign	Het
Skint3	A	G	4: 112,253,918	K80R	probably damaging	Het
Slc11a1	G	A	1: 74,384,706	A398T	probably damaging	Het
Sspo	G	T	6: 48,476,571	E2887*	probably null	Het
Tmc5	A	C	7: 118,645,369	Y490S	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tnfsf8	G	T	4: 63,860,959	T34K	possibly damaging	Het
Trim5	T	A	7: 104,276,835	N173I	probably damaging	Het
Vkorc1l1	A	T	5: 129,982,271	I109L	probably benign	Het
Vmn1r214	A	G	13: 23,034,641	T102A	probably benign	Het
Wdr19	A	G	5: 65,228,292	D579G	possibly damaging	Het
Zfp955b	T	C	17: 33,302,994	I479T	probably benign	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCGTGTACCTAAAACCAGTTGG -3'
(R):5'- GTCCGAAGTCTTGGGTCAAC -3'

Sequencing Primer
(F):5'- CCAGTTGGTGAAAGATTAGCTC -3'
(R):5'- GGGTCAACCACTTGATTTCTTTTC -3'

Posted On

2015-04-17