Incidental Mutation 'R3893:Rin2'
ID310026
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene NameRas and Rab interactor 2
SynonymsRASSF4, 4632403N06Rik, 2010003K16Rik
MMRRC Submission 040805-MU
Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145675215-145887616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145860446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 354 (T354I)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
Predicted Effect probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145860006 splice site probably benign
IGL03222:Rin2 APN 2 145860195 nonsense probably null
IGL03371:Rin2 APN 2 145885926 utr 3 prime probably benign
IGL03411:Rin2 APN 2 145860944 missense probably damaging 0.99
D4043:Rin2 UTSW 2 145822363 missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145878832 splice site probably benign
R0110:Rin2 UTSW 2 145861033 missense probably benign
R0144:Rin2 UTSW 2 145876639 missense probably damaging 0.96
R0510:Rin2 UTSW 2 145861033 missense probably benign
R1326:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1327:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1328:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1329:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1330:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1544:Rin2 UTSW 2 145858446 missense probably damaging 1.00
R1658:Rin2 UTSW 2 145876456 missense probably benign 0.04
R1832:Rin2 UTSW 2 145861171 missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145878940 missense probably damaging 1.00
R2137:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2167:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2170:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2260:Rin2 UTSW 2 145878904 missense probably damaging 0.97
R2312:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2884:Rin2 UTSW 2 145860991 missense probably benign 0.07
R3155:Rin2 UTSW 2 145860851 missense probably benign 0.17
R3771:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3772:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3773:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3822:Rin2 UTSW 2 145822630 missense probably benign 0.02
R3824:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3825:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3885:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3939:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3940:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4012:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4019:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4058:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4214:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4231:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4232:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4236:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4372:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4410:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4415:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4471:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4490:Rin2 UTSW 2 145822274 missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145860905 missense probably benign 0.01
R5099:Rin2 UTSW 2 145878901 missense probably damaging 1.00
R5268:Rin2 UTSW 2 145844760 missense probably benign
R5493:Rin2 UTSW 2 145860709 missense probably damaging 1.00
R5622:Rin2 UTSW 2 145860379 missense probably benign 0.07
R5947:Rin2 UTSW 2 145844943 intron probably benign
R6280:Rin2 UTSW 2 145861019 missense probably damaging 1.00
R7009:Rin2 UTSW 2 145883475 missense probably damaging 1.00
R7531:Rin2 UTSW 2 145858499 missense probably benign
R7824:Rin2 UTSW 2 145861117 missense probably benign 0.00
R8065:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8067:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8144:Rin2 UTSW 2 145822305 missense probably benign
R8510:Rin2 UTSW 2 145885691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACTCCCAACGCGAATG -3'
(R):5'- AAAGGCTCATGTCGCTCAGC -3'

Sequencing Primer
(F):5'- GAATGGCACCGAGAGACCTC -3'
(R):5'- TGTGATTCAGAGCCGGGC -3'
Posted On2015-04-17