Incidental Mutation 'R3893:Tnfsf8'
ID310027
Institutional Source Beutler Lab
Gene Symbol Tnfsf8
Ensembl Gene ENSMUSG00000028362
Gene Nametumor necrosis factor (ligand) superfamily, member 8
SynonymsCD153, CD30LG, Cd30L
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3893 (G1)
Quality Score153
Status Validated
Chromosome4
Chromosomal Location63831308-63861347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63860959 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 34 (T34K)
Ref Sequence ENSEMBL: ENSMUSP00000030047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030047
AA Change: T34K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030047
Gene: ENSMUSG00000028362
AA Change: T34K

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
TNF 103 235 2.64e-27 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice diplay decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Tnfsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Tnfsf8 APN 4 63834510 splice site probably benign
P0045:Tnfsf8 UTSW 4 63851167 splice site probably benign
R0322:Tnfsf8 UTSW 4 63834166 missense probably damaging 0.96
R1167:Tnfsf8 UTSW 4 63837086 missense possibly damaging 0.55
R3821:Tnfsf8 UTSW 4 63860890 missense probably benign 0.17
R4154:Tnfsf8 UTSW 4 63834358 missense probably benign 0.00
R4380:Tnfsf8 UTSW 4 63861027 nonsense probably null
R4597:Tnfsf8 UTSW 4 63837100 missense probably damaging 1.00
R7502:Tnfsf8 UTSW 4 63851161 missense probably damaging 1.00
R7740:Tnfsf8 UTSW 4 63834446 missense possibly damaging 0.70
R8062:Tnfsf8 UTSW 4 63861195 start gained probably benign
R8126:Tnfsf8 UTSW 4 63834186 missense possibly damaging 0.94
R8301:Tnfsf8 UTSW 4 63860878 missense probably benign 0.31
R8335:Tnfsf8 UTSW 4 63834115 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCATTAGCTTCCCAGAGCTG -3'
(R):5'- CACATGATCCAGGATGCAGG -3'

Sequencing Primer
(F):5'- CCCAGAGCTGTTCCTCTAGAG -3'
(R):5'- ATGCAGGGGAAAATCCTTCTTG -3'
Posted On2015-04-17