Incidental Mutation 'R3893:Chd5'
ID310031
Institutional Source Beutler Lab
Gene Symbol Chd5
Ensembl Gene ENSMUSG00000005045
Gene Namechromodomain helicase DNA binding protein 5
Synonyms
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152338651-152390194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152360656 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 365 (R365G)
Ref Sequence ENSEMBL: ENSMUSP00000005175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]
Predicted Effect probably damaging
Transcript: ENSMUST00000005175
AA Change: R365G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: R365G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030775
AA Change: R365G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: R365G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164662
AA Change: R365G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: R365G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Meta Mutation Damage Score 0.6768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Chd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Chd5 APN 4 152360602 missense probably damaging 1.00
IGL00886:Chd5 APN 4 152359699 missense probably benign 0.00
IGL00963:Chd5 APN 4 152382938 missense probably damaging 1.00
IGL01399:Chd5 APN 4 152356687 missense probably damaging 1.00
IGL01571:Chd5 APN 4 152384115 splice site probably benign
IGL01606:Chd5 APN 4 152360975 missense probably damaging 0.99
IGL01636:Chd5 APN 4 152384653 nonsense probably null
IGL02009:Chd5 APN 4 152366213 missense probably damaging 1.00
IGL02417:Chd5 APN 4 152367294 missense probably damaging 0.97
IGL02504:Chd5 APN 4 152363322 missense probably damaging 0.99
IGL02508:Chd5 APN 4 152363024 missense probably damaging 1.00
IGL02597:Chd5 APN 4 152371712 missense probably damaging 1.00
IGL02608:Chd5 APN 4 152356107 missense possibly damaging 0.94
IGL02612:Chd5 APN 4 152360576 missense probably damaging 1.00
IGL02658:Chd5 APN 4 152360593 missense probably damaging 1.00
IGL02662:Chd5 APN 4 152372131 missense probably damaging 1.00
IGL02676:Chd5 APN 4 152356073 splice site probably benign
IGL02871:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL02942:Chd5 APN 4 152385725 missense probably damaging 0.98
IGL02956:Chd5 APN 4 152379956 missense probably benign 0.00
IGL03286:Chd5 APN 4 152385495 missense probably benign 0.00
IGL03348:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL03398:Chd5 APN 4 152377082 missense probably damaging 0.97
PIT1430001:Chd5 UTSW 4 152370637 missense probably damaging 1.00
PIT4151001:Chd5 UTSW 4 152378529 missense probably damaging 0.99
R0079:Chd5 UTSW 4 152385749 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0379:Chd5 UTSW 4 152383321 missense probably benign 0.00
R0388:Chd5 UTSW 4 152371644 missense probably damaging 1.00
R0675:Chd5 UTSW 4 152385950 missense probably benign 0.06
R0730:Chd5 UTSW 4 152347984 missense possibly damaging 0.72
R0799:Chd5 UTSW 4 152384159 missense probably damaging 1.00
R0800:Chd5 UTSW 4 152356157 missense probably damaging 1.00
R1276:Chd5 UTSW 4 152378734 missense probably damaging 1.00
R1752:Chd5 UTSW 4 152375133 missense probably damaging 1.00
R1753:Chd5 UTSW 4 152378815 missense probably damaging 1.00
R1843:Chd5 UTSW 4 152385806 missense probably damaging 1.00
R1850:Chd5 UTSW 4 152370533 missense probably damaging 1.00
R1851:Chd5 UTSW 4 152378270 missense probably damaging 0.97
R1859:Chd5 UTSW 4 152380523 missense probably benign 0.00
R1983:Chd5 UTSW 4 152384666 missense possibly damaging 0.89
R2404:Chd5 UTSW 4 152367334 missense probably damaging 1.00
R2897:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R2898:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R3938:Chd5 UTSW 4 152377055 missense probably benign 0.05
R4707:Chd5 UTSW 4 152360582 missense probably damaging 1.00
R4754:Chd5 UTSW 4 152377746 missense probably damaging 0.99
R4911:Chd5 UTSW 4 152360672 missense probably damaging 1.00
R4924:Chd5 UTSW 4 152366429 missense possibly damaging 0.50
R4926:Chd5 UTSW 4 152383311 missense probably benign 0.00
R5256:Chd5 UTSW 4 152372097 missense probably benign 0.01
R5524:Chd5 UTSW 4 152376630 missense probably benign
R5552:Chd5 UTSW 4 152385815 missense possibly damaging 0.95
R5895:Chd5 UTSW 4 152379932 missense probably benign 0.13
R5945:Chd5 UTSW 4 152379951 missense probably benign
R6007:Chd5 UTSW 4 152379421 missense probably null 1.00
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6172:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6173:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6323:Chd5 UTSW 4 152367334 missense probably damaging 0.99
R6331:Chd5 UTSW 4 152382408 missense probably benign 0.02
R6495:Chd5 UTSW 4 152367372 missense probably damaging 1.00
R6528:Chd5 UTSW 4 152356676 missense probably damaging 1.00
R6849:Chd5 UTSW 4 152378538 missense probably damaging 1.00
R6854:Chd5 UTSW 4 152382938 missense probably damaging 1.00
R6859:Chd5 UTSW 4 152378207 missense probably damaging 1.00
R6999:Chd5 UTSW 4 152374434 missense probably damaging 1.00
R7034:Chd5 UTSW 4 152360941 missense possibly damaging 0.89
R7110:Chd5 UTSW 4 152385439 missense probably damaging 1.00
R7361:Chd5 UTSW 4 152363288 missense probably damaging 0.99
R7397:Chd5 UTSW 4 152368012 missense possibly damaging 0.82
R7440:Chd5 UTSW 4 152384651 missense probably benign 0.01
R7489:Chd5 UTSW 4 152373468 missense probably damaging 1.00
R7810:Chd5 UTSW 4 152358575 missense probably damaging 0.97
R8057:Chd5 UTSW 4 152366372 missense probably damaging 1.00
R8078:Chd5 UTSW 4 152360991 missense possibly damaging 0.90
R8092:Chd5 UTSW 4 152378804 missense probably damaging 0.99
R8170:Chd5 UTSW 4 152376583 missense probably benign 0.26
R8255:Chd5 UTSW 4 152379423 missense probably damaging 0.99
R8348:Chd5 UTSW 4 152360716 missense probably damaging 0.98
R8448:Chd5 UTSW 4 152360716 missense probably damaging 0.98
Z1176:Chd5 UTSW 4 152378479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCATGTGCCAGTCGAGTC -3'
(R):5'- AGCCATTCACCGTTCGGTATC -3'

Sequencing Primer
(F):5'- CCAGTCGAGTCGGGGTAGTG -3'
(R):5'- GCAGAACTCCATGTGGTCATC -3'
Posted On2015-04-17