Incidental Mutation 'R3893:Rsbn1l'
ID310033
Institutional Source Beutler Lab
Gene Symbol Rsbn1l
Ensembl Gene ENSMUSG00000039968
Gene Nameround spermatid basic protein 1-like
SynonymsC330002G24Rik, 8430412F05Rik
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location20893028-20956398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20905840 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 500 (R500H)
Ref Sequence ENSEMBL: ENSMUSP00000142789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036489] [ENSMUST00000196780]
Predicted Effect probably damaging
Transcript: ENSMUST00000036489
AA Change: R500H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039482
Gene: ENSMUSG00000039968
AA Change: R500H

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196780
AA Change: R500H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142789
Gene: ENSMUSG00000039968
AA Change: R500H

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Meta Mutation Damage Score 0.9282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Rsbn1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Rsbn1l APN 5 20896155 missense probably benign 0.08
IGL01631:Rsbn1l APN 5 20896571 missense probably damaging 1.00
IGL01631:Rsbn1l APN 5 20896572 missense probably damaging 1.00
IGL02237:Rsbn1l APN 5 20919606 missense probably benign 0.39
IGL02434:Rsbn1l APN 5 20919734 missense probably damaging 0.99
IGL02458:Rsbn1l APN 5 20951736 missense probably damaging 0.99
IGL02994:Rsbn1l APN 5 20908234 missense probably damaging 1.00
PIT4280001:Rsbn1l UTSW 5 20919655 missense probably damaging 1.00
R0288:Rsbn1l UTSW 5 20920040 missense probably damaging 0.97
R1429:Rsbn1l UTSW 5 20920018 missense probably damaging 1.00
R1524:Rsbn1l UTSW 5 20951673 missense probably damaging 1.00
R1713:Rsbn1l UTSW 5 20951490 missense probably benign 0.18
R1875:Rsbn1l UTSW 5 20951698 missense probably benign 0.17
R1998:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R1999:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2000:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2504:Rsbn1l UTSW 5 20902366 missense probably damaging 1.00
R2566:Rsbn1l UTSW 5 20919769 missense probably benign 0.40
R3434:Rsbn1l UTSW 5 20905930 splice site probably benign
R3789:Rsbn1l UTSW 5 20896108 missense probably benign 0.24
R3924:Rsbn1l UTSW 5 20919787 missense probably damaging 1.00
R4335:Rsbn1l UTSW 5 20908193 missense probably null 0.45
R4422:Rsbn1l UTSW 5 20896546 missense probably damaging 1.00
R5131:Rsbn1l UTSW 5 20896245 missense possibly damaging 0.89
R5212:Rsbn1l UTSW 5 20896214 missense probably benign 0.03
R5739:Rsbn1l UTSW 5 20905816 missense probably damaging 1.00
R6736:Rsbn1l UTSW 5 20908224 missense probably benign 0.45
R6980:Rsbn1l UTSW 5 20896484 missense probably benign
R7252:Rsbn1l UTSW 5 20908198 missense probably damaging 1.00
R7443:Rsbn1l UTSW 5 20927623 missense possibly damaging 0.61
R7538:Rsbn1l UTSW 5 20896457 missense probably benign 0.01
R7914:Rsbn1l UTSW 5 20905898 missense probably damaging 1.00
R8396:Rsbn1l UTSW 5 20927667 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATGGCCCATTTGGTCCTTG -3'
(R):5'- CATCTGTTGGCTTTCAGGTCGA -3'

Sequencing Primer
(F):5'- CCTTGTTTGGATAGATAAGTGGGCAC -3'
(R):5'- GCTTTCAGGTCGAGTTTTAATTTTTC -3'
Posted On2015-04-17