Mutagenetix > Incidental Mutation

Incidental Mutation 'R3893:Wdr19'

310034

Institutional Source

Beutler Lab

Gene Symbol

Wdr19

Ensembl Gene

ENSMUSG00000037890

Gene Name

WD repeat domain 19

Synonyms

MMRRC Submission

040805-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65199696-65260415 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65228292 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 579 (D579G)

Ref Sequence

ENSEMBL: ENSMUSP00000144866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]

AlphaFold

Q3UGF1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041892
AA Change: D579G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: D579G

Domain	Start	End	E-Value	Type
WD40	6	42	4.26e1	SMART
WD40	44	83	2.13e1	SMART
WD40	85	125	2.75e1	SMART
WD40	128	166	2.67e-1	SMART
Blast:WD40	220	258	6e-9	BLAST
WD40	264	302	1.46e-1	SMART
Blast:WD40	308	347	2e-18	BLAST
Pfam:WD40_3	508	564	2.7e-32	PFAM
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1259	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203359

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203653
AA Change: D579G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: D579G

Domain	Start	End	E-Value	Type
WD40	6	42	4.26e1	SMART
WD40	44	83	2.13e1	SMART
WD40	85	125	2.75e1	SMART
WD40	128	166	2.67e-1	SMART
Blast:WD40	220	258	6e-9	BLAST
WD40	264	302	1.46e-1	SMART
Blast:WD40	308	347	2e-18	BLAST
Pfam:WD40_3	508	564	2.7e-32	PFAM
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1259	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204375

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204647

Meta Mutation Damage Score

0.1646

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	A	1: 37,631,458	M134L	probably benign	Het
2610303G11Rik	A	T	9: 98,186,811		noncoding transcript	Het
Adam19	C	T	11: 46,128,838	A455V	probably damaging	Het
Akr1c19	G	A	13: 4,238,442	D140N	probably damaging	Het
Atoh1	A	G	6: 64,730,133	T271A	probably damaging	Het
Atp6v0a2	G	A	5: 124,639,265	R168Q	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cadps	A	G	14: 12,488,883		probably benign	Het
Cfap69	A	T	5: 5,581,245	V61E	probably damaging	Het
Chd5	A	G	4: 152,360,656	R365G	probably damaging	Het
Dnajc18	A	T	18: 35,700,995		probably null	Het
Fam49a	T	C	12: 12,362,525	V232A	probably benign	Het
Fmnl1	T	A	11: 103,196,757		probably benign	Het
Gca	A	G	2: 62,679,220	Y89C	probably damaging	Het
Gcnt2	A	G	13: 40,860,446	Y31C	probably benign	Het
Gem	C	T	4: 11,705,889		probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
Gprin3	T	C	6: 59,354,479	Y281C	probably benign	Het
H2-M11	A	G	17: 36,547,090	T6A	probably benign	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lrrk1	T	C	7: 66,278,520		probably benign	Het
Macf1	A	G	4: 123,486,406	Y1298H	probably damaging	Het
Micu3	C	T	8: 40,366,224	L315F	probably damaging	Het
Pkd1	G	A	17: 24,572,110		probably null	Het
Pkhd1	A	T	1: 20,312,138	Y2596*	probably null	Het
Pnliprp2	A	G	19: 58,766,273	S250G	probably benign	Het
Prkcq	A	C	2: 11,226,971	E35A	probably damaging	Het
Prpf8	C	A	11: 75,500,257	S1377R	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rsbn1l	C	T	5: 20,905,840	R500H	probably damaging	Het
Sart3	C	T	5: 113,746,636	E636K	probably benign	Het
Skint3	A	G	4: 112,253,918	K80R	probably damaging	Het
Slc11a1	G	A	1: 74,384,706	A398T	probably damaging	Het
Sspo	G	T	6: 48,476,571	E2887*	probably null	Het
Tmc5	A	C	7: 118,645,369	Y490S	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tnfsf8	G	T	4: 63,860,959	T34K	possibly damaging	Het
Trim5	T	A	7: 104,276,835	N173I	probably damaging	Het
Vkorc1l1	A	T	5: 129,982,271	I109L	probably benign	Het
Vmn1r214	A	G	13: 23,034,641	T102A	probably benign	Het
Zc3h6	A	G	2: 129,016,140	Y697C	probably damaging	Het
Zfp955b	T	C	17: 33,302,994	I479T	probably benign	Het

Other mutations in Wdr19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Wdr19	APN	5	65252299	missense	probably benign	0.41
IGL01346:Wdr19	APN	5	65221739	splice site	probably benign
IGL01761:Wdr19	APN	5	65215820	missense	possibly damaging	0.60
IGL01845:Wdr19	APN	5	65225366	missense	probably damaging	0.98
IGL01977:Wdr19	APN	5	65228569	missense	probably benign
IGL02314:Wdr19	APN	5	65257120	missense	probably benign	0.26
IGL02455:Wdr19	APN	5	65224759	missense	probably benign	0.01
IGL02542:Wdr19	APN	5	65231071	missense	probably benign
IGL02616:Wdr19	APN	5	65223581	missense	probably damaging	0.97
IGL02661:Wdr19	APN	5	65245808	missense	probably benign	0.06
IGL02927:Wdr19	APN	5	65252378	missense	possibly damaging	0.80
IGL02958:Wdr19	APN	5	65212807	splice site	probably null
IGL03083:Wdr19	APN	5	65230976	missense	probably benign	0.01
IGL03332:Wdr19	APN	5	65227143	missense	possibly damaging	0.89
detritus	UTSW	5	65212891	missense	possibly damaging	0.59
R4609_Wdr19_503	UTSW	5	65228542	missense	possibly damaging	0.83
R7190_Wdr19_539	UTSW	5	65240862	missense	probably benign	0.35
refuse	UTSW	5	65228292	missense	possibly damaging	0.64
R0924:Wdr19	UTSW	5	65256439	splice site	probably benign
R1178:Wdr19	UTSW	5	65223865	missense	probably damaging	0.98
R1229:Wdr19	UTSW	5	65256391	missense	possibly damaging	0.94
R1434:Wdr19	UTSW	5	65223504	splice site	probably benign
R1543:Wdr19	UTSW	5	65224690	missense	probably benign	0.06
R1819:Wdr19	UTSW	5	65212891	missense	possibly damaging	0.59
R1971:Wdr19	UTSW	5	65241160	splice site	probably benign
R2190:Wdr19	UTSW	5	65244166	missense	possibly damaging	0.89
R2274:Wdr19	UTSW	5	65240991	missense	possibly damaging	0.62
R3106:Wdr19	UTSW	5	65202623	missense	probably benign	0.20
R3753:Wdr19	UTSW	5	65224726	missense	probably damaging	1.00
R4609:Wdr19	UTSW	5	65228542	missense	possibly damaging	0.83
R5284:Wdr19	UTSW	5	65225409	missense	probably damaging	1.00
R5328:Wdr19	UTSW	5	65244179	missense	probably damaging	1.00
R5530:Wdr19	UTSW	5	65228219	missense	probably benign
R5837:Wdr19	UTSW	5	65202957	missense	probably benign	0.08
R5902:Wdr19	UTSW	5	65227139	missense	probably benign	0.09
R6065:Wdr19	UTSW	5	65221713	missense	probably benign
R6419:Wdr19	UTSW	5	65215893	missense	possibly damaging	0.63
R6495:Wdr19	UTSW	5	65258123	missense	probably benign	0.00
R6916:Wdr19	UTSW	5	65225334	missense	possibly damaging	0.64
R7020:Wdr19	UTSW	5	65256314	missense	probably damaging	0.99
R7190:Wdr19	UTSW	5	65240862	missense	probably benign	0.35
R7972:Wdr19	UTSW	5	65223850	missense	probably damaging	1.00
R8328:Wdr19	UTSW	5	65225295	missense	probably damaging	0.97
R8390:Wdr19	UTSW	5	65223867	nonsense	probably null
R8960:Wdr19	UTSW	5	65240868	missense	probably benign
R9260:Wdr19	UTSW	5	65206446	missense	possibly damaging	0.90
X0028:Wdr19	UTSW	5	65244144	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCAGCCTCTTAACAAGGC -3'
(R):5'- GGTCAGTTCTCCATTGTATAACAGC -3'

Sequencing Primer
(F):5'- GCCATTTGTAATGACAGACACGTG -3'
(R):5'- GCCAAAATAACCTTGGATCCTGTATC -3'

Posted On

2015-04-17