Incidental Mutation 'R3893:Sart3'
ID310035
Institutional Source Beutler Lab
Gene Symbol Sart3
Ensembl Gene ENSMUSG00000018974
Gene Namesquamous cell carcinoma antigen recognized by T cells 3
Synonyms
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R3893 (G1)
Quality Score221
Status Validated
Chromosome5
Chromosomal Location113742446-113772510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113746636 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 636 (E636K)
Ref Sequence ENSEMBL: ENSMUSP00000019118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000197041]
Predicted Effect probably benign
Transcript: ENSMUST00000019118
AA Change: E636K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974
AA Change: E636K

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196738
Predicted Effect probably benign
Transcript: ENSMUST00000197041
SMART Domains Protein: ENSMUSP00000143778
Gene: ENSMUSG00000018974

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
Blast:HAT 292 323 1e-5 BLAST
HAT 325 357 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198246
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding nuclear protein that is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is found to be an important cellular factor for HIV-1 gene expression and viral replication. It also associates transiently with U6 and U4/U6 snRNPs during the recycling phase of the spliceosome cycle. This encoded protein is thought to be involved in the regulation of mRNA splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in hematopoietic cells exhibit protection against the effects of 5-FU treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Sart3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sart3 APN 5 113746669 missense probably benign
IGL01309:Sart3 APN 5 113759250 missense probably damaging 1.00
IGL01844:Sart3 APN 5 113745648 nonsense probably null
IGL02147:Sart3 APN 5 113762943 splice site probably benign
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0268:Sart3 UTSW 5 113752399 missense probably damaging 0.99
R1703:Sart3 UTSW 5 113752219 missense probably benign 0.22
R1704:Sart3 UTSW 5 113746007 missense probably benign 0.14
R1998:Sart3 UTSW 5 113747921 critical splice donor site probably null
R2142:Sart3 UTSW 5 113764093 missense probably damaging 0.97
R3895:Sart3 UTSW 5 113752427 nonsense probably null
R4231:Sart3 UTSW 5 113771418 missense probably benign
R5367:Sart3 UTSW 5 113759216 splice site probably null
R5488:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5489:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5668:Sart3 UTSW 5 113745156 splice site probably null
R5903:Sart3 UTSW 5 113751239 missense probably damaging 0.98
R6046:Sart3 UTSW 5 113755446 missense probably damaging 1.00
R6173:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6215:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6216:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6221:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6222:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6320:Sart3 UTSW 5 113751240 missense probably benign 0.34
R6824:Sart3 UTSW 5 113744539 splice site probably null
R6978:Sart3 UTSW 5 113745746 missense probably damaging 0.97
R7062:Sart3 UTSW 5 113745602 missense possibly damaging 0.49
R7162:Sart3 UTSW 5 113762835 missense probably damaging 1.00
R7165:Sart3 UTSW 5 113745995 missense probably benign 0.01
R7222:Sart3 UTSW 5 113746656 missense probably benign 0.01
R7235:Sart3 UTSW 5 113753642 missense probably damaging 1.00
R7237:Sart3 UTSW 5 113754246 missense possibly damaging 0.70
R7340:Sart3 UTSW 5 113744667 missense probably benign 0.02
R7580:Sart3 UTSW 5 113754379 splice site probably null
R7637:Sart3 UTSW 5 113771352 missense probably benign 0.14
R8146:Sart3 UTSW 5 113747957 missense probably damaging 0.98
R8241:Sart3 UTSW 5 113745968 missense probably benign 0.32
X0058:Sart3 UTSW 5 113745928 missense probably benign
Z1176:Sart3 UTSW 5 113745824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGTCTTTAGCAGAGTCAC -3'
(R):5'- TGTATTGTATGAGGGTTCCCACC -3'

Sequencing Primer
(F):5'- GTCTTTAGCAGAGTCACTACTGAGAG -3'
(R):5'- GAACGAACGCCCTGTCCTCTC -3'
Posted On2015-04-17