Incidental Mutation 'R3893:Atp6v0a2'
ID 310036
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2, TJ6s
MMRRC Submission 040805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R3893 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 124767117-124801519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124777203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 168 (R168Q)
Ref Sequence ENSEMBL: ENSMUSP00000143284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
AlphaFold P15920
Predicted Effect probably damaging
Transcript: ENSMUST00000037865
AA Change: R168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: R168Q

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197931
Predicted Effect probably damaging
Transcript: ENSMUST00000198382
AA Change: R168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023
AA Change: R168Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200292
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik A T 9: 98,068,864 (GRCm39) noncoding transcript Het
Adam19 C T 11: 46,019,665 (GRCm39) A455V probably damaging Het
Akr1c19 G A 13: 4,288,441 (GRCm39) D140N probably damaging Het
Atoh1 A G 6: 64,707,117 (GRCm39) T271A probably damaging Het
B930094E09Rik G A 18: 31,742,742 (GRCm39) S59N unknown Het
Cadps A G 14: 12,488,883 (GRCm38) probably benign Het
Cfap69 A T 5: 5,631,245 (GRCm39) V61E probably damaging Het
Chd5 A G 4: 152,445,113 (GRCm39) R365G probably damaging Het
Cracdl T A 1: 37,670,539 (GRCm39) M134L probably benign Het
Cyria T C 12: 12,412,526 (GRCm39) V232A probably benign Het
Dnajc18 A T 18: 35,834,048 (GRCm39) probably null Het
Fmnl1 T A 11: 103,087,583 (GRCm39) probably benign Het
Gca A G 2: 62,509,564 (GRCm39) Y89C probably damaging Het
Gcnt2 A G 13: 41,013,922 (GRCm39) Y31C probably benign Het
Gem C T 4: 11,705,889 (GRCm39) probably benign Het
Ggps1 T C 13: 14,228,284 (GRCm39) K300E probably benign Het
Gpc5 T C 14: 115,607,472 (GRCm39) M358T probably benign Het
Gprin3 T C 6: 59,331,464 (GRCm39) Y281C probably benign Het
H2-M11 A G 17: 36,857,982 (GRCm39) T6A probably benign Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Lrrk1 T C 7: 65,928,268 (GRCm39) probably benign Het
Macf1 A G 4: 123,380,199 (GRCm39) Y1298H probably damaging Het
Micu3 C T 8: 40,819,265 (GRCm39) L315F probably damaging Het
Pkd1 G A 17: 24,791,084 (GRCm39) probably null Het
Pkhd1 A T 1: 20,382,362 (GRCm39) Y2596* probably null Het
Pnliprp2 A G 19: 58,754,705 (GRCm39) S250G probably benign Het
Prkcq A C 2: 11,231,782 (GRCm39) E35A probably damaging Het
Prpf8 C A 11: 75,391,083 (GRCm39) S1377R possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rsbn1l C T 5: 21,110,838 (GRCm39) R500H probably damaging Het
Sart3 C T 5: 113,884,697 (GRCm39) E636K probably benign Het
Skint3 A G 4: 112,111,115 (GRCm39) K80R probably damaging Het
Slc11a1 G A 1: 74,423,865 (GRCm39) A398T probably damaging Het
Sspo G T 6: 48,453,505 (GRCm39) E2887* probably null Het
Tmc5 A C 7: 118,244,592 (GRCm39) Y490S probably damaging Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tnfsf8 G T 4: 63,779,196 (GRCm39) T34K possibly damaging Het
Trim5 T A 7: 103,926,042 (GRCm39) N173I probably damaging Het
Vkorc1l1 A T 5: 130,011,112 (GRCm39) I109L probably benign Het
Vmn1r214 A G 13: 23,218,811 (GRCm39) T102A probably benign Het
Wdr19 A G 5: 65,385,635 (GRCm39) D579G possibly damaging Het
Zc3h6 A G 2: 128,858,060 (GRCm39) Y697C probably damaging Het
Zfp955b T C 17: 33,521,968 (GRCm39) I479T probably benign Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124,798,841 (GRCm39) missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124,783,968 (GRCm39) missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124,774,043 (GRCm39) missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124,783,954 (GRCm39) missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124,798,849 (GRCm39) missense probably benign
IGL02650:Atp6v0a2 APN 5 124,789,426 (GRCm39) splice site probably benign
IGL02687:Atp6v0a2 APN 5 124,791,206 (GRCm39) missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124,767,267 (GRCm39) missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124,789,845 (GRCm39) missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124,791,171 (GRCm39) splice site probably benign
IGL03198:Atp6v0a2 APN 5 124,789,425 (GRCm39) critical splice donor site probably null
alkaline UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
basic UTSW 5 124,789,392 (GRCm39) nonsense probably null
electronegative UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
energizer UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
Everready UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
Lithium UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124,790,248 (GRCm39) missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124,795,046 (GRCm39) missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124,795,552 (GRCm39) missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124,765,209 (GRCm39) unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124,789,860 (GRCm39) missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124,784,674 (GRCm39) missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124,784,667 (GRCm39) missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124,790,249 (GRCm39) missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124,790,241 (GRCm39) missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124,784,649 (GRCm39) missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124,783,909 (GRCm39) nonsense probably null
R5830:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124,793,391 (GRCm39) missense probably benign
R5903:Atp6v0a2 UTSW 5 124,789,343 (GRCm39) missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124,767,268 (GRCm39) missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124,790,194 (GRCm39) missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124,779,452 (GRCm39) missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124,789,225 (GRCm39) splice site probably null
R6994:Atp6v0a2 UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124,783,923 (GRCm39) missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124,784,676 (GRCm39) missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124,789,392 (GRCm39) nonsense probably null
R7714:Atp6v0a2 UTSW 5 124,775,533 (GRCm39) missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124,791,262 (GRCm39) missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124,793,560 (GRCm39) missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124,782,969 (GRCm39) missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R7977:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R7987:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124,789,837 (GRCm39) missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124,796,152 (GRCm39) missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124,793,534 (GRCm39) missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124,784,589 (GRCm39) missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124,797,061 (GRCm39) missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124,796,138 (GRCm39) missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124,789,312 (GRCm39) missense probably damaging 0.98
R9360:Atp6v0a2 UTSW 5 124,767,259 (GRCm39) missense possibly damaging 0.77
R9601:Atp6v0a2 UTSW 5 124,790,257 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTGTTCACCTGTCAG -3'
(R):5'- AGGTCCCTTCGGCTTTTAGC -3'

Sequencing Primer
(F):5'- GTTCACCTGTCAGGCTTGGC -3'
(R):5'- GCTACATCAATGCTGCATGACTAAG -3'
Posted On 2015-04-17