Mutagenetix > Incidental Mutation

Incidental Mutation 'R3893:Atp6v0a2'

310036

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

040805-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R3893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124639265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 168 (R168Q)

Ref Sequence

ENSEMBL: ENSMUSP00000143284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: R168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: R168Q

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197931

Predicted Effect

probably damaging
Transcript: ENSMUST00000198382
AA Change: R168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023
AA Change: R168Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200292

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	A	1: 37,631,458	M134L	probably benign	Het
2610303G11Rik	A	T	9: 98,186,811		noncoding transcript	Het
Adam19	C	T	11: 46,128,838	A455V	probably damaging	Het
Akr1c19	G	A	13: 4,238,442	D140N	probably damaging	Het
Atoh1	A	G	6: 64,730,133	T271A	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cadps	A	G	14: 12,488,883		probably benign	Het
Cfap69	A	T	5: 5,581,245	V61E	probably damaging	Het
Chd5	A	G	4: 152,360,656	R365G	probably damaging	Het
Dnajc18	A	T	18: 35,700,995		probably null	Het
Fam49a	T	C	12: 12,362,525	V232A	probably benign	Het
Fmnl1	T	A	11: 103,196,757		probably benign	Het
Gca	A	G	2: 62,679,220	Y89C	probably damaging	Het
Gcnt2	A	G	13: 40,860,446	Y31C	probably benign	Het
Gem	C	T	4: 11,705,889		probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
Gprin3	T	C	6: 59,354,479	Y281C	probably benign	Het
H2-M11	A	G	17: 36,547,090	T6A	probably benign	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lrrk1	T	C	7: 66,278,520		probably benign	Het
Macf1	A	G	4: 123,486,406	Y1298H	probably damaging	Het
Micu3	C	T	8: 40,366,224	L315F	probably damaging	Het
Pkd1	G	A	17: 24,572,110		probably null	Het
Pkhd1	A	T	1: 20,312,138	Y2596*	probably null	Het
Pnliprp2	A	G	19: 58,766,273	S250G	probably benign	Het
Prkcq	A	C	2: 11,226,971	E35A	probably damaging	Het
Prpf8	C	A	11: 75,500,257	S1377R	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rsbn1l	C	T	5: 20,905,840	R500H	probably damaging	Het
Sart3	C	T	5: 113,746,636	E636K	probably benign	Het
Skint3	A	G	4: 112,253,918	K80R	probably damaging	Het
Slc11a1	G	A	1: 74,384,706	A398T	probably damaging	Het
Sspo	G	T	6: 48,476,571	E2887*	probably null	Het
Tmc5	A	C	7: 118,645,369	Y490S	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tnfsf8	G	T	4: 63,860,959	T34K	possibly damaging	Het
Trim5	T	A	7: 104,276,835	N173I	probably damaging	Het
Vkorc1l1	A	T	5: 129,982,271	I109L	probably benign	Het
Vmn1r214	A	G	13: 23,034,641	T102A	probably benign	Het
Wdr19	A	G	5: 65,228,292	D579G	possibly damaging	Het
Zc3h6	A	G	2: 129,016,140	Y697C	probably damaging	Het
Zfp955b	T	C	17: 33,302,994	I479T	probably benign	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCTGTTCACCTGTCAG -3'
(R):5'- AGGTCCCTTCGGCTTTTAGC -3'

Sequencing Primer
(F):5'- GTTCACCTGTCAGGCTTGGC -3'
(R):5'- GCTACATCAATGCTGCATGACTAAG -3'

Posted On

2015-04-17