Incidental Mutation 'R3893:Gprin3'
ID310038
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene NameGPRIN family member 3
Synonyms
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location59347226-59426294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59354479 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 281 (Y281C)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
Predicted Effect probably benign
Transcript: ENSMUST00000051065
AA Change: Y281C

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: Y281C

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59353837 missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59355325 utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59354191 missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59353162 missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59354473 missense probably benign 0.02
IGL02801:Gprin3 APN 6 59354981 missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59355028 missense probably benign
R0505:Gprin3 UTSW 6 59353387 missense probably damaging 0.98
R0944:Gprin3 UTSW 6 59353915 missense possibly damaging 0.72
R1028:Gprin3 UTSW 6 59354609 missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59354936 missense possibly damaging 0.86
R1290:Gprin3 UTSW 6 59354464 missense possibly damaging 0.53
R2060:Gprin3 UTSW 6 59354519 missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59354149 missense probably benign 0.13
R3830:Gprin3 UTSW 6 59353633 missense probably benign 0.12
R3983:Gprin3 UTSW 6 59354560 missense possibly damaging 0.72
R4812:Gprin3 UTSW 6 59353365 missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59354173 missense probably benign 0.33
R4944:Gprin3 UTSW 6 59354659 missense probably benign 0.00
R5523:Gprin3 UTSW 6 59353946 nonsense probably null
R5677:Gprin3 UTSW 6 59353892 missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59354413 missense possibly damaging 0.86
R5879:Gprin3 UTSW 6 59354713 missense probably benign
R5881:Gprin3 UTSW 6 59354786 missense probably benign 0.18
R6044:Gprin3 UTSW 6 59353672 missense possibly damaging 0.72
R6272:Gprin3 UTSW 6 59353331 nonsense probably null
R7140:Gprin3 UTSW 6 59355143 missense possibly damaging 0.85
R7528:Gprin3 UTSW 6 59354032 missense possibly damaging 0.85
R7891:Gprin3 UTSW 6 59353711 missense probably benign 0.22
R7974:Gprin3 UTSW 6 59353711 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATGACACGCAGTTGCTCCTG -3'
(R):5'- TCAATAACATCACCGCGGTG -3'

Sequencing Primer
(F):5'- GCCCATTCTCTAGCTCAGGAG -3'
(R):5'- GTGTCCAGTGAACCTCCAGTAAG -3'
Posted On2015-04-17