Incidental Mutation 'R3893:Lrrk1'
ID310041
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 66278520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]
Predicted Effect probably benign
Transcript: ENSMUST00000015277
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145954
SMART Domains Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
Pfam:Pkinase 158 435 6.6e-46 PFAM
Pfam:Pkinase_Tyr 159 435 5.8e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGTGGTCTCTGCTAACAC -3'
(R):5'- CTTCCTGGAGAACAGCAAGC -3'

Sequencing Primer
(F):5'- GGTAGCAATATTAAGGCCTCACTTGG -3'
(R):5'- CAGCAAGCTGGAGCACACG -3'
Posted On2015-04-17