Incidental Mutation 'R3893:Trim5'
ID310042
Institutional Source Beutler Lab
Gene Symbol Trim5
Ensembl Gene ENSMUSG00000060441
Gene Nametripartite motif-containing 5
Synonyms
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104263386-104288094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104276835 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 173 (N173I)
Ref Sequence ENSEMBL: ENSMUSP00000095781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000098179]
Predicted Effect probably benign
Transcript: ENSMUST00000051795
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098179
AA Change: N173I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441
AA Change: N173I

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138557
AA Change: N173I

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119127
Gene: ENSMUSG00000060441
AA Change: N173I

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 173 232 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Trim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Trim5 APN 7 104279431 missense probably damaging 1.00
IGL02165:Trim5 APN 7 104279359 missense probably damaging 1.00
IGL02576:Trim5 APN 7 104278417 missense probably damaging 0.97
IGL02660:Trim5 APN 7 104266218 missense probably damaging 0.96
IGL02732:Trim5 APN 7 104278465 missense probably benign 0.02
R0278:Trim5 UTSW 7 104279675 missense probably benign 0.00
R0373:Trim5 UTSW 7 104265684 missense probably benign 0.00
R0508:Trim5 UTSW 7 104265604 missense probably null 0.98
R0840:Trim5 UTSW 7 104265771 missense probably damaging 1.00
R0947:Trim5 UTSW 7 104265751 missense probably damaging 1.00
R1432:Trim5 UTSW 7 104279519 missense probably benign 0.04
R1432:Trim5 UTSW 7 104279521 missense probably benign
R1770:Trim5 UTSW 7 104276661 missense probably damaging 1.00
R1782:Trim5 UTSW 7 104265816 splice site probably null
R1988:Trim5 UTSW 7 104265621 missense probably damaging 0.99
R2140:Trim5 UTSW 7 104276791 nonsense probably null
R3110:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3112:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3948:Trim5 UTSW 7 104266520 nonsense probably null
R4114:Trim5 UTSW 7 104265740 missense probably damaging 0.99
R4249:Trim5 UTSW 7 104276815 missense possibly damaging 0.83
R4352:Trim5 UTSW 7 104276808 missense probably damaging 1.00
R4595:Trim5 UTSW 7 104265432 missense probably damaging 1.00
R5057:Trim5 UTSW 7 104265423 missense probably damaging 1.00
R5583:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R5861:Trim5 UTSW 7 104279519 missense probably benign 0.04
R5861:Trim5 UTSW 7 104279521 missense probably benign
R7027:Trim5 UTSW 7 104265668 missense probably benign 0.00
R7078:Trim5 UTSW 7 104278474 missense possibly damaging 0.85
R7150:Trim5 UTSW 7 104276810 missense probably damaging 0.96
R7657:Trim5 UTSW 7 104276677 missense possibly damaging 0.51
R7660:Trim5 UTSW 7 104279362 missense probably damaging 1.00
R7737:Trim5 UTSW 7 104279564 missense probably damaging 1.00
R7821:Trim5 UTSW 7 104278426 missense probably benign 0.32
R7861:Trim5 UTSW 7 104266468 critical splice donor site probably null
R8167:Trim5 UTSW 7 104278423 missense probably damaging 0.99
R8220:Trim5 UTSW 7 104276826 missense probably damaging 0.96
R8296:Trim5 UTSW 7 104265786 missense probably damaging 1.00
Z1088:Trim5 UTSW 7 104266225 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACCTTGTGCAGCCTTACCTG -3'
(R):5'- GTCTGAGGAAAGCTGACCAG -3'

Sequencing Primer
(F):5'- GAGCACTGTAACTGATGTTCCAC -3'
(R):5'- ATGATGGAGCAGGCTTCCAATCTC -3'
Posted On2015-04-17