Incidental Mutation 'R3893:Micu3'
ID310044
Institutional Source Beutler Lab
Gene Symbol Micu3
Ensembl Gene ENSMUSG00000039478
Gene Namemitochondrial calcium uptake family, member 3
SynonymsEfha2, 2900075B16Rik
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40307458-40386308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40366224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 315 (L315F)
Ref Sequence ENSEMBL: ENSMUSP00000070241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068999]
Predicted Effect probably damaging
Transcript: ENSMUST00000068999
AA Change: L315F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070241
Gene: ENSMUSG00000039478
AA Change: L315F

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EFh 229 257 3.93e0 SMART
Blast:EFh 332 360 1e-5 BLAST
EFh 467 495 5.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132481
Predicted Effect unknown
Transcript: ENSMUST00000136835
AA Change: L53F
SMART Domains Protein: ENSMUSP00000118883
Gene: ENSMUSG00000039478
AA Change: L53F

DomainStartEndE-ValueType
EFh 5 33 6.6e-2 SMART
Blast:EFh 71 99 9e-6 BLAST
EFh 206 234 5.36e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Micu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Micu3 APN 8 40382130 missense possibly damaging 0.90
R0491:Micu3 UTSW 8 40366253 splice site probably benign
R1518:Micu3 UTSW 8 40335852 missense possibly damaging 0.94
R2089:Micu3 UTSW 8 40308372 missense probably benign 0.01
R3115:Micu3 UTSW 8 40382167 missense probably benign 0.21
R4026:Micu3 UTSW 8 40359455 intron probably benign
R4094:Micu3 UTSW 8 40335888 missense probably null 1.00
R4595:Micu3 UTSW 8 40359397 intron probably benign
R4678:Micu3 UTSW 8 40380677 missense probably damaging 1.00
R5501:Micu3 UTSW 8 40354300 unclassified probably null
R6327:Micu3 UTSW 8 40366197 missense probably benign 0.13
R6793:Micu3 UTSW 8 40380695 missense probably damaging 0.99
R7292:Micu3 UTSW 8 40382125 missense probably benign 0.09
R7350:Micu3 UTSW 8 40348958 missense probably benign 0.09
R7427:Micu3 UTSW 8 40378914 missense possibly damaging 0.86
R7453:Micu3 UTSW 8 40335898 missense probably benign
R7635:Micu3 UTSW 8 40366234 missense possibly damaging 0.76
X0003:Micu3 UTSW 8 40366222 missense probably benign 0.00
Z1177:Micu3 UTSW 8 40308224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGTGTGCAACTGAAAGAC -3'
(R):5'- TACTGCCTTTAGTGCTGAGCC -3'

Sequencing Primer
(F):5'- CAGTGGGCTCGTTTCCC -3'
(R):5'- TTTAGTGCTGAGCCGCCAC -3'
Posted On2015-04-17