Incidental Mutation 'R3893:Akr1c19'
ID310052
Institutional Source Beutler Lab
Gene Symbol Akr1c19
Ensembl Gene ENSMUSG00000071551
Gene Namealdo-keto reductase family 1, member C19
Synonyms
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location4228700-4252843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4238442 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 140 (D140N)
Ref Sequence ENSEMBL: ENSMUSP00000112666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081326] [ENSMUST00000118663]
Predicted Effect probably damaging
Transcript: ENSMUST00000081326
AA Change: D140N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080074
Gene: ENSMUSG00000071551
AA Change: D140N

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 1.4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118663
AA Change: D140N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112666
Gene: ENSMUSG00000071551
AA Change: D140N

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 9.9e-67 PFAM
Meta Mutation Damage Score 0.1730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Akr1c19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Akr1c19 APN 13 4248129 utr 3 prime probably benign
IGL01522:Akr1c19 APN 13 4239099 splice site probably benign
IGL01625:Akr1c19 APN 13 4233817 missense probably damaging 1.00
IGL02863:Akr1c19 APN 13 4237113 nonsense probably null
IGL03094:Akr1c19 APN 13 4236185 missense probably benign 0.22
IGL03232:Akr1c19 APN 13 4238463 missense probably damaging 0.96
R0504:Akr1c19 UTSW 13 4236251 missense possibly damaging 0.83
R0538:Akr1c19 UTSW 13 4237100 missense probably damaging 1.00
R0607:Akr1c19 UTSW 13 4238460 missense probably benign 0.09
R2068:Akr1c19 UTSW 13 4238392 critical splice acceptor site probably null
R3701:Akr1c19 UTSW 13 4243033 missense probably damaging 1.00
R4369:Akr1c19 UTSW 13 4233780 nonsense probably null
R4434:Akr1c19 UTSW 13 4242616 missense probably benign 0.28
R5545:Akr1c19 UTSW 13 4242595 missense probably benign 0.01
R5584:Akr1c19 UTSW 13 4243032 missense probably damaging 1.00
R6988:Akr1c19 UTSW 13 4233758 start gained probably benign
R7286:Akr1c19 UTSW 13 4246819 missense probably damaging 1.00
R7365:Akr1c19 UTSW 13 4237070 missense probably benign 0.01
R7879:Akr1c19 UTSW 13 4236224 missense probably damaging 1.00
R8177:Akr1c19 UTSW 13 4242592 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGACTAGTTCAAGCACCCAAG -3'
(R):5'- CAGCAGAATCCAGTCATTCCTG -3'

Sequencing Primer
(F):5'- TAGTTCAAGCACCCAAGAATACTG -3'
(R):5'- GCAGAATCCAGTCATTCCTGTTGTC -3'
Posted On2015-04-17