Incidental Mutation 'R3749:Tas2r136'
ID310092
Institutional Source Beutler Lab
Gene Symbol Tas2r136
Ensembl Gene ENSMUSG00000053217
Gene Nametaste receptor, type 2, member 136
SynonymsTas2r36, mt2r52
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132777179-132778162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132777237 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 309 (F309Y)
Ref Sequence ENSEMBL: ENSMUSP00000070791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065532]
Predicted Effect probably damaging
Transcript: ENSMUST00000065532
AA Change: F309Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070791
Gene: ENSMUSG00000053217
AA Change: F309Y

DomainStartEndE-ValueType
Pfam:TAS2R 23 317 8.4e-68 PFAM
Meta Mutation Damage Score 0.2471 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAS2R44 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Tas2r136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tas2r136 APN 6 132777198 missense probably damaging 1.00
IGL02414:Tas2r136 APN 6 132777531 missense possibly damaging 0.87
IGL02662:Tas2r136 APN 6 132777708 missense probably damaging 1.00
R0607:Tas2r136 UTSW 6 132777412 missense probably benign 0.09
R0785:Tas2r136 UTSW 6 132777927 missense probably benign
R1727:Tas2r136 UTSW 6 132777790 missense possibly damaging 0.63
R2101:Tas2r136 UTSW 6 132777532 missense probably benign 0.09
R2975:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3080:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3746:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R3750:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R4362:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4411:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4413:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4803:Tas2r136 UTSW 6 132777492 missense probably damaging 1.00
R5283:Tas2r136 UTSW 6 132777411 missense probably damaging 0.99
R5343:Tas2r136 UTSW 6 132778080 missense probably benign 0.00
R5738:Tas2r136 UTSW 6 132777744 missense probably damaging 1.00
R5872:Tas2r136 UTSW 6 132777331 missense possibly damaging 0.46
R6770:Tas2r136 UTSW 6 132777382 missense probably benign 0.03
R7326:Tas2r136 UTSW 6 132777906 missense possibly damaging 0.65
R7845:Tas2r136 UTSW 6 132777870 missense probably benign 0.05
R7900:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
R7928:Tas2r136 UTSW 6 132777870 missense probably benign 0.05
R7983:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTTATGCCTGGCTTCATAATTCTG -3'
(R):5'- TCAACCCACATTAAGGTTTTGCAAG -3'

Sequencing Primer
(F):5'- GCCTGGCTTCATAATTCTGAAAAATG -3'
(R):5'- CCCACATTAAGGTTTTGCAAGTTTTG -3'
Posted On2015-04-17