Incidental Mutation 'R3749:Vmn1r158'
ID310093
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Namevomeronasal 1 receptor 158
SynonymsGm16455
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R3749 (G1)
Quality Score187
Status Not validated
Chromosome7
Chromosomal Location22789859-22790782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22790214 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 190 (L190W)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
Predicted Effect probably damaging
Transcript: ENSMUST00000174643
AA Change: L190W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: L190W

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22790779 missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22790445 missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22790647 missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22790430 missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22790390 missense probably benign 0.03
R4872:Vmn1r158 UTSW 7 22790754 missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22790374 missense probably benign
R6500:Vmn1r158 UTSW 7 22790653 missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22790691 missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22790040 missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22789881 missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22790676 missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22790224 missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22790300 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATGTGACCACCAGCATCAGG -3'
(R):5'- TGTCACTCTGGTTCCTCTTAATAGAG -3'

Sequencing Primer
(F):5'- CATCAGGATAGTACGGGTTGCTC -3'
(R):5'- CTTAGAGCAAGTGTCACAAACATGGC -3'
Posted On2015-04-17