Incidental Mutation 'R3749:Faap24'
ID310094
Institutional Source Beutler Lab
Gene Symbol Faap24
Ensembl Gene ENSMUSG00000030493
Gene NameFanconi anemia core complex associated protein 24
SynonymsC230052I12Rik
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35392152-35396836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35393012 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 160 (V160D)
Ref Sequence ENSEMBL: ENSMUSP00000115766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032704] [ENSMUST00000032705] [ENSMUST00000079414] [ENSMUST00000085556] [ENSMUST00000141704] [ENSMUST00000154597] [ENSMUST00000206854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032704
AA Change: V160D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032704
Gene: ENSMUSG00000030493
AA Change: V160D

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032705
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085556
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141001
Predicted Effect probably benign
Transcript: ENSMUST00000141704
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154597
AA Change: V160D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115766
Gene: ENSMUSG00000030493
AA Change: V160D

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206854
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP24 is a component of the Fanconi anemia (FA) core complex (see MIM 227650), which plays a crucial role in DNA damage response (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Faap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02265:Faap24 APN 7 35396264 missense probably benign 0.01
IGL02951:Faap24 APN 7 35392951 missense probably damaging 0.98
IGL03351:Faap24 APN 7 35395309 nonsense probably null
R0030:Faap24 UTSW 7 35392860 missense probably damaging 0.97
R0606:Faap24 UTSW 7 35394963 unclassified probably benign
R1378:Faap24 UTSW 7 35392901 missense probably benign 0.06
R4661:Faap24 UTSW 7 35395084 missense probably benign 0.00
R6279:Faap24 UTSW 7 35396284 missense possibly damaging 0.90
R7025:Faap24 UTSW 7 35392871 missense possibly damaging 0.84
R7074:Faap24 UTSW 7 35395102 missense possibly damaging 0.92
R7171:Faap24 UTSW 7 35392854 nonsense probably null
R7249:Faap24 UTSW 7 35395060 missense probably benign
R7566:Faap24 UTSW 7 35393040 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGAAGGCAGAGTCAGCTG -3'
(R):5'- ACAAGCCACACAGATATTTGGG -3'

Sequencing Primer
(F):5'- CAGAGTCAGCTGCGGGG -3'
(R):5'- GGTTCAAGAGCAAACCAGA -3'
Posted On2015-04-17