Incidental Mutation 'R3749:Olfr803'
ID310104
Institutional Source Beutler Lab
Gene Symbol Olfr803
Ensembl Gene ENSMUSG00000046041
Gene Nameolfactory receptor 803
SynonymsGA_x6K02T2PULF-11370664-11369738, MOR111-3
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3749 (G1)
Quality Score221
Status Validated
Chromosome10
Chromosomal Location129690621-129694286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129691961 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 27 (V27I)
Ref Sequence ENSEMBL: ENSMUSP00000145400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056736] [ENSMUST00000203785] [ENSMUST00000204641] [ENSMUST00000217576]
Predicted Effect probably benign
Transcript: ENSMUST00000056736
AA Change: V27I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055860
Gene: ENSMUSG00000046041
AA Change: V27I

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 3.8e-6 PFAM
Pfam:7tm_1 39 288 3.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157522
Predicted Effect probably benign
Transcript: ENSMUST00000203785
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204641
AA Change: V27I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145400
Gene: ENSMUSG00000046041
AA Change: V27I

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.9e-49 PFAM
Pfam:7tm_1 39 288 8.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217576
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Olfr803
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Olfr803 APN 10 129691454 missense probably benign 0.00
IGL01298:Olfr803 APN 10 129692029 missense probably damaging 0.98
IGL02008:Olfr803 APN 10 129692018 missense probably benign 0.02
IGL02166:Olfr803 APN 10 129691913 missense probably benign 0.12
IGL02598:Olfr803 APN 10 129691273 missense possibly damaging 0.89
IGL03158:Olfr803 APN 10 129691718 missense probably benign 0.01
IGL03393:Olfr803 APN 10 129691278 missense probably damaging 0.99
R2246:Olfr803 UTSW 10 129691943 missense probably damaging 1.00
R5060:Olfr803 UTSW 10 129691830 missense probably benign
R5116:Olfr803 UTSW 10 129691397 missense probably damaging 1.00
R5253:Olfr803 UTSW 10 129691732 missense probably damaging 0.99
R6166:Olfr803 UTSW 10 129691279 missense probably damaging 1.00
R6543:Olfr803 UTSW 10 129691990 missense probably benign 0.09
R6787:Olfr803 UTSW 10 129691522 missense possibly damaging 0.88
R6828:Olfr803 UTSW 10 129691994 missense probably damaging 1.00
R7284:Olfr803 UTSW 10 129691351 missense probably benign
R7510:Olfr803 UTSW 10 129691920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTAATTATTGATGCCAGGAATCTG -3'
(R):5'- TGCAGCAAGTCTTACAAGGAAG -3'

Sequencing Primer
(F):5'- CAGGAATCTGGGAATGGAAACACTAG -3'
(R):5'- TCTTACAAGGAAGGGAAGTCATTGC -3'
Posted On2015-04-17