Incidental Mutation 'R3749:Lrp10'
ID310112
Institutional Source Beutler Lab
Gene Symbol Lrp10
Ensembl Gene ENSMUSG00000022175
Gene Namelow-density lipoprotein receptor-related protein 10
SynonymsLrp9
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54464137-54471497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54469266 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 520 (N520I)
Ref Sequence ENSEMBL: ENSMUSP00000022782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022782] [ENSMUST00000227760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022782
AA Change: N520I

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022782
Gene: ENSMUSG00000022175
AA Change: N520I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CUB 29 137 5.33e-2 SMART
LDLa 140 177 5.26e-13 SMART
CUB 193 306 2.57e-4 SMART
LDLa 308 356 1.05e-3 SMART
LDLa 357 399 4.89e-2 SMART
LDLa 400 436 1.63e-9 SMART
transmembrane domain 442 464 N/A INTRINSIC
low complexity region 544 569 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 634 655 N/A INTRINSIC
low complexity region 672 681 N/A INTRINSIC
low complexity region 685 710 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226472
Predicted Effect probably benign
Transcript: ENSMUST00000227760
Predicted Effect unknown
Transcript: ENSMUST00000228407
AA Change: T114S
Meta Mutation Damage Score 0.3391 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a low density lipoprotein receptor family protein. A similar protein in mouse is thought to play a role in the uptake of apolipoprotein E-containing lipoproteins. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Lrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Lrp10 APN 14 54468662 nonsense probably null
IGL02641:Lrp10 APN 14 54468611 nonsense probably null
IGL02697:Lrp10 APN 14 54469697 missense probably damaging 1.00
IGL02974:Lrp10 APN 14 54467884 nonsense probably null
IGL03030:Lrp10 APN 14 54469162 missense possibly damaging 0.69
chowmein UTSW 14 54468090 missense probably damaging 1.00
egg_fu_young UTSW 14 54469266 missense possibly damaging 0.66
R0452:Lrp10 UTSW 14 54467579 missense probably benign 0.08
R0765:Lrp10 UTSW 14 54468090 missense probably damaging 1.00
R1700:Lrp10 UTSW 14 54469752 missense possibly damaging 0.94
R1726:Lrp10 UTSW 14 54469656 missense probably damaging 0.99
R2943:Lrp10 UTSW 14 54469845 unclassified probably benign
R3746:Lrp10 UTSW 14 54469266 missense possibly damaging 0.66
R4356:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4357:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4358:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4379:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4380:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4751:Lrp10 UTSW 14 54468592 missense probably damaging 1.00
R5055:Lrp10 UTSW 14 54468345 missense probably benign 0.00
R5133:Lrp10 UTSW 14 54469610 missense probably benign
R6633:Lrp10 UTSW 14 54469074 missense probably benign 0.03
R6845:Lrp10 UTSW 14 54469688 missense probably damaging 1.00
R6874:Lrp10 UTSW 14 54468213 missense possibly damaging 0.50
R6958:Lrp10 UTSW 14 54469821 unclassified probably benign
R6989:Lrp10 UTSW 14 54468493 missense probably benign 0.30
R7162:Lrp10 UTSW 14 54465706 missense possibly damaging 0.60
R7453:Lrp10 UTSW 14 54468456 missense probably damaging 1.00
R7600:Lrp10 UTSW 14 54469395 missense possibly damaging 0.93
X0026:Lrp10 UTSW 14 54469399 nonsense probably null
X0027:Lrp10 UTSW 14 54468535 missense probably damaging 1.00
Z1088:Lrp10 UTSW 14 54467922 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAACTTATGTCTAAGTGGCCCTC -3'
(R):5'- CCGAGCTGGGGTATTAGTTC -3'

Sequencing Primer
(F):5'- GCTGAGATTGTGCAGCAAC -3'
(R):5'- TATTAGTTCGAGGAAGCAGGCCC -3'
Posted On2015-04-17