Mutagenetix > Incidental Mutations

Incidental Mutation 'R3749:Mroh2b'

310114

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

040734-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R3749 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 4952246 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 1513 (W1513*)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

probably null
Transcript: ENSMUST00000045736
AA Change: W1513*

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W1513*

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226849

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228458

Meta Mutation Damage Score

0.9718

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam19	A	T	11: 46,137,610	D690V	probably benign	Het
Ankib1	G	T	5: 3,734,097	P293Q	probably damaging	Het
Arhgap19	T	A	19: 41,774,079	E461V	probably damaging	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Ccdc40	T	C	11: 119,264,426	V1164A	probably benign	Het
Cfhr1	C	A	1: 139,557,634		probably null	Het
Colq	A	T	14: 31,549,453		probably benign	Het
Daam1	C	A	12: 71,971,166	D716E	probably damaging	Het
Dnah17	T	C	11: 118,082,916	S1935G	probably benign	Het
Dnah8	A	T	17: 30,784,174	K3616*	probably null	Het
Faap24	A	T	7: 35,393,012	V160D	possibly damaging	Het
Gpc1	C	A	1: 92,857,582	C414*	probably null	Het
Igkv9-120	G	A	6: 68,050,001	A7T	probably benign	Het
Kcnu1	T	A	8: 25,886,770	C391S	probably null	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Lrp10	A	T	14: 54,469,266	N520I	possibly damaging	Het
March6	A	G	15: 31,462,014	V856A	probably benign	Het
Mfsd1	T	C	3: 67,582,953	S46P	probably benign	Het
Mme	T	A	3: 63,343,540	V334E	probably damaging	Het
Nuf2	T	A	1: 169,525,376	N20I	probably damaging	Het
Obsl1	T	C	1: 75,498,246	T642A	probably benign	Het
Olfm1	C	T	2: 28,208,088	T54I	probably damaging	Het
Olfr803	C	T	10: 129,691,961	V27I	probably benign	Het
Olfr95	G	A	17: 37,211,800	R18C	possibly damaging	Het
Osbpl7	T	C	11: 97,056,053	V223A	probably damaging	Het
Patj	A	G	4: 98,469,600	Y701C	probably damaging	Het
Pkdrej	T	A	15: 85,821,077	K219N	probably damaging	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Slc25a25	G	T	2: 32,420,380	N122K	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Supt16	A	G	14: 52,180,139	L306P	probably damaging	Het
Syne1	C	T	10: 5,052,267		probably benign	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Terb1	T	C	8: 104,496,834	D114G	probably damaging	Het
Tlr5	T	C	1: 182,974,439	I436T	probably benign	Het
Tpcn2	T	C	7: 145,255,523	H682R	probably damaging	Het
Tpi1	T	A	6: 124,812,791	S130C	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Uggt2	A	T	14: 119,057,672	V38E	probably benign	Het
Vmn1r158	A	C	7: 22,790,214	L190W	probably damaging	Het
Vwa5b2	A	G	16: 20,598,326		probably benign	Het
Wnt2	T	C	6: 18,023,168	I161V	probably benign	Het
Zdhhc25	C	T	15: 88,601,023	S187L	probably benign	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zkscan1	T	C	5: 138,101,441	S476P	probably damaging	Het
Zmynd8	A	G	2: 165,805,198	Y945H	probably damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCATGACAACTTTCAGTC -3'
(R):5'- AGGTAACACATTTCTTCCCACTG -3'

Sequencing Primer
(F):5'- CAGTCAATTAATGTATGGCGATGG -3'
(R):5'- ACTGCCCCCGATGTCCATC -3'

Posted On

2015-04-17