Incidental Mutation 'R3749:Olfr95'
ID310121
Institutional Source Beutler Lab
Gene Symbol Olfr95
Ensembl Gene ENSMUSG00000049561
Gene Nameolfactory receptor 95
SynonymsMOR263-6, GA_x6K02T2PSCP-1651760-1650822
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37207950-37213118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37211800 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 18 (R18C)
Ref Sequence ENSEMBL: ENSMUSP00000150480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060728] [ENSMUST00000216318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060728
AA Change: R18C

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058929
Gene: ENSMUSG00000049561
AA Change: R18C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.9e-57 PFAM
Pfam:7TM_GPCR_Srsx 34 259 1.7e-6 PFAM
Pfam:7tm_1 40 289 2.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216318
AA Change: R18C

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Olfr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Olfr95 APN 17 37210986 missense probably damaging 1.00
IGL03306:Olfr95 APN 17 37211677 missense probably damaging 1.00
PIT4377001:Olfr95 UTSW 17 37211089 missense probably benign 0.00
R0668:Olfr95 UTSW 17 37211644 missense probably damaging 1.00
R0909:Olfr95 UTSW 17 37210918 missense probably benign 0.33
R1442:Olfr95 UTSW 17 37211704 missense probably benign 0.00
R1557:Olfr95 UTSW 17 37211353 missense probably damaging 1.00
R1758:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R3195:Olfr95 UTSW 17 37211536 missense possibly damaging 0.87
R3778:Olfr95 UTSW 17 37211758 missense probably benign
R4458:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R4591:Olfr95 UTSW 17 37211119 missense probably benign
R5058:Olfr95 UTSW 17 37211667 missense probably damaging 1.00
R5060:Olfr95 UTSW 17 37211416 missense probably benign 0.00
R5903:Olfr95 UTSW 17 37211021 nonsense probably null
R6294:Olfr95 UTSW 17 37211626 missense probably benign 0.19
R6689:Olfr95 UTSW 17 37211157 missense probably damaging 1.00
R7196:Olfr95 UTSW 17 37211193 missense probably damaging 1.00
R7677:Olfr95 UTSW 17 37211495 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAACATTTGCAGAGCGC -3'
(R):5'- TTGTGCCTGGACATCTCAG -3'

Sequencing Primer
(F):5'- GGGACTGTGACCGACGTGTAG -3'
(R):5'- GTGCCTGGACATCTCAGTTCTAAG -3'
Posted On2015-04-17