Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:2310035C23Rik'

310124

Institutional Source

Beutler Lab

Gene Symbol

2310035C23Rik

Ensembl Gene

ENSMUSG00000026319

Gene Name

RIKEN cDNA 2310035C23 gene

Synonyms

MMRRC Submission

040735-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105663861-105755191 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105753577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1178 (T1178I)

Ref Sequence

ENSEMBL: ENSMUSP00000141162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039173
AA Change: T1202I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: T1202I

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
LisH	231	263	1.25e-3	SMART
coiled coil region	334	372	N/A	INTRINSIC
SCOP:d1b3ua_	532	1069	4e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000086721
AA Change: T1202I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: T1202I

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
coiled coil region	197	232	N/A	INTRINSIC
LisH	255	287	1.25e-3	SMART
coiled coil region	358	396	N/A	INTRINSIC
SCOP:d1b3ua_	556	1093	5e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185692

Predicted Effect

probably benign
Transcript: ENSMUST00000186807

SMART Domains

Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
coiled coil region	197	232	N/A	INTRINSIC
LisH	255	287	3.9e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188588

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190459

Predicted Effect

probably damaging
Transcript: ENSMUST00000190501
AA Change: T1178I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: T1178I

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
LisH	231	263	1.25e-3	SMART
coiled coil region	334	372	N/A	INTRINSIC
SCOP:d1b3ua_	532	1069	4e-22	SMART

Meta Mutation Damage Score

0.1037

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in 2310035C23Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:2310035C23Rik	APN	1	105696599	splice site	probably benign
IGL02393:2310035C23Rik	APN	1	105687368	missense	probably damaging	1.00
IGL02655:2310035C23Rik	APN	1	105678246	missense	probably damaging	1.00
IGL02992:2310035C23Rik	APN	1	105719464	missense	possibly damaging	0.89
IGL03170:2310035C23Rik	APN	1	105735955	missense	probably damaging	0.99
detention	UTSW	1	105750396	missense	possibly damaging	0.54
hiatus	UTSW	1	105721305	missense	probably benign	0.17
limbo	UTSW	1	105692960	missense	probably benign
IGL03050:2310035C23Rik	UTSW	1	105726381	missense	probably damaging	0.98
R0022:2310035C23Rik	UTSW	1	105691902	splice site	probably benign
R0399:2310035C23Rik	UTSW	1	105750959	splice site	probably benign
R1243:2310035C23Rik	UTSW	1	105750364	missense	probably damaging	1.00
R1563:2310035C23Rik	UTSW	1	105719534	missense	probably damaging	1.00
R1760:2310035C23Rik	UTSW	1	105719444	splice site	probably benign
R1894:2310035C23Rik	UTSW	1	105664576	missense	probably benign	0.12
R2036:2310035C23Rik	UTSW	1	105743254	missense	probably damaging	1.00
R2428:2310035C23Rik	UTSW	1	105746126	missense	possibly damaging	0.88
R2905:2310035C23Rik	UTSW	1	105691994	missense	probably benign	0.04
R3121:2310035C23Rik	UTSW	1	105725799	missense	probably benign	0.15
R3886:2310035C23Rik	UTSW	1	105692213	missense	probably benign	0.14
R4284:2310035C23Rik	UTSW	1	105721287	missense	probably damaging	0.98
R4671:2310035C23Rik	UTSW	1	105718859	missense	probably benign	0.00
R4706:2310035C23Rik	UTSW	1	105692279	missense	probably benign	0.28
R4760:2310035C23Rik	UTSW	1	105721305	missense	probably benign	0.17
R4776:2310035C23Rik	UTSW	1	105719535	nonsense	probably null
R5031:2310035C23Rik	UTSW	1	105664514	missense	probably damaging	1.00
R5051:2310035C23Rik	UTSW	1	105691986	missense	possibly damaging	0.85
R5085:2310035C23Rik	UTSW	1	105678180	missense	probably damaging	0.99
R5104:2310035C23Rik	UTSW	1	105731240	missense	probably benign	0.45
R5187:2310035C23Rik	UTSW	1	105718809	nonsense	probably null
R5259:2310035C23Rik	UTSW	1	105721376	missense	probably benign	0.01
R5435:2310035C23Rik	UTSW	1	105741250	intron	probably benign
R5444:2310035C23Rik	UTSW	1	105726384	missense	possibly damaging	0.60
R5490:2310035C23Rik	UTSW	1	105719501	missense	probably damaging	0.99
R5513:2310035C23Rik	UTSW	1	105750973	missense	probably damaging	0.99
R5556:2310035C23Rik	UTSW	1	105693167	missense	probably benign
R5734:2310035C23Rik	UTSW	1	105703883	intron	probably benign
R5779:2310035C23Rik	UTSW	1	105687347	missense	probably damaging	1.00
R5822:2310035C23Rik	UTSW	1	105718856	missense	probably damaging	1.00
R5878:2310035C23Rik	UTSW	1	105692960	missense	probably benign
R6015:2310035C23Rik	UTSW	1	105691958	missense	probably damaging	1.00
R6051:2310035C23Rik	UTSW	1	105721272	missense	probably damaging	1.00
R6266:2310035C23Rik	UTSW	1	105731282	critical splice donor site	probably null
R6556:2310035C23Rik	UTSW	1	105726440	missense	probably damaging	1.00
R6571:2310035C23Rik	UTSW	1	105692982	missense	probably benign
R6612:2310035C23Rik	UTSW	1	105692007	missense	possibly damaging	0.72
R6852:2310035C23Rik	UTSW	1	105753595	missense	probably damaging	1.00
R7209:2310035C23Rik	UTSW	1	105750357	missense	probably damaging	1.00
R7284:2310035C23Rik	UTSW	1	105734583	missense	probably benign	0.01
R7292:2310035C23Rik	UTSW	1	105721416	critical splice donor site	probably null
R7534:2310035C23Rik	UTSW	1	105741023	missense	probably benign	0.01
R7740:2310035C23Rik	UTSW	1	105731261	missense	probably damaging	1.00
R8036:2310035C23Rik	UTSW	1	105678177	missense	probably damaging	1.00
R8234:2310035C23Rik	UTSW	1	105753510	missense	possibly damaging	0.93
R8797:2310035C23Rik	UTSW	1	105750396	missense	possibly damaging	0.54
R8819:2310035C23Rik	UTSW	1	105726454	missense	possibly damaging	0.91
R8820:2310035C23Rik	UTSW	1	105726454	missense	possibly damaging	0.91
R8880:2310035C23Rik	UTSW	1	105664495	missense	probably damaging	0.99
R9173:2310035C23Rik	UTSW	1	105750403	missense	probably benign
R9229:2310035C23Rik	UTSW	1	105686984	missense	possibly damaging	0.95
R9307:2310035C23Rik	UTSW	1	105687352	missense	probably benign	0.02
R9334:2310035C23Rik	UTSW	1	105726454	missense	possibly damaging	0.91
R9412:2310035C23Rik	UTSW	1	105734563	missense	probably benign	0.09
R9467:2310035C23Rik	UTSW	1	105741314	missense	probably damaging	0.99
R9509:2310035C23Rik	UTSW	1	105686979	missense	probably damaging	1.00
R9562:2310035C23Rik	UTSW	1	105664151	missense	probably damaging	0.99
R9565:2310035C23Rik	UTSW	1	105664151	missense	probably damaging	0.99
Z1176:2310035C23Rik	UTSW	1	105719615	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CCATGTGTGGTGTTAACTGC -3'
(R):5'- GCAGTGCAAATATCTTTGGAGG -3'

Sequencing Primer
(F):5'- CTCAGTAGGTTAAGGCACTGC -3'
(R):5'- CAGTGCAAATATCTTTGGAGGTTAGG -3'

Posted On

2015-04-17