Incidental Mutation 'R3750:Tcp11l1'
ID310127
Institutional Source Beutler Lab
Gene Symbol Tcp11l1
Ensembl Gene ENSMUSG00000027175
Gene Namet-complex 11 like 1
Synonyms
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104657288-104712169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104698542 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 137 (I137T)
Ref Sequence ENSEMBL: ENSMUSP00000106747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028597] [ENSMUST00000111118]
Predicted Effect probably damaging
Transcript: ENSMUST00000028597
AA Change: I137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028597
Gene: ENSMUSG00000027175
AA Change: I137T

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
Pfam:Tcp11 78 502 3.9e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111118
AA Change: I137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106747
Gene: ENSMUSG00000027175
AA Change: I137T

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
Pfam:Tcp11 77 505 5.2e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137428
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Tcp11l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Tcp11l1 APN 2 104706486 missense probably benign
IGL01999:Tcp11l1 APN 2 104698569 missense possibly damaging 0.61
IGL02792:Tcp11l1 APN 2 104681820 missense probably benign 0.19
R0376:Tcp11l1 UTSW 2 104697505 splice site probably benign
R0683:Tcp11l1 UTSW 2 104681892 missense possibly damaging 0.90
R0828:Tcp11l1 UTSW 2 104699836 splice site probably benign
R2091:Tcp11l1 UTSW 2 104684139 missense possibly damaging 0.77
R2095:Tcp11l1 UTSW 2 104681840 missense probably damaging 1.00
R4456:Tcp11l1 UTSW 2 104684222 missense probably damaging 1.00
R4926:Tcp11l1 UTSW 2 104681785 missense probably benign 0.01
R5184:Tcp11l1 UTSW 2 104699944 missense probably damaging 1.00
R5461:Tcp11l1 UTSW 2 104688511 missense probably benign 0.00
R6979:Tcp11l1 UTSW 2 104706439 missense probably benign
R7387:Tcp11l1 UTSW 2 104699930 missense possibly damaging 0.92
R7443:Tcp11l1 UTSW 2 104684135 missense probably benign 0.01
R7872:Tcp11l1 UTSW 2 104706492 missense probably benign 0.25
R7940:Tcp11l1 UTSW 2 104698648 missense probably damaging 1.00
R8399:Tcp11l1 UTSW 2 104685375 missense probably benign 0.09
R8431:Tcp11l1 UTSW 2 104699969 missense probably damaging 0.96
R8445:Tcp11l1 UTSW 2 104681933 missense probably benign 0.02
V8831:Tcp11l1 UTSW 2 104685484 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGTACAAAAGTAGAACCTTCAGG -3'
(R):5'- AAGATTTGTTACTCGATCGCCATAG -3'

Sequencing Primer
(F):5'- CCTTCAGGTTATCATGACTTGGTG -3'
(R):5'- GTCTTTAGCTTGGAGAAGAG -3'
Posted On2015-04-17