Incidental Mutation 'R3750:Skil'
ID310131
Institutional Source Beutler Lab
Gene Symbol Skil
Ensembl Gene ENSMUSG00000027660
Gene NameSKI-like
Synonyms9130011J04Rik, SnoN2, Skir, SnoN, sno-dE3
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location31095058-31122577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31116834 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 354 (N354S)
Ref Sequence ENSEMBL: ENSMUSP00000113054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029194] [ENSMUST00000117728] [ENSMUST00000118204] [ENSMUST00000118470]
Predicted Effect probably benign
Transcript: ENSMUST00000029194
AA Change: N480S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029194
Gene: ENSMUSG00000027660
AA Change: N480S

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 233 2e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 419 437 N/A INTRINSIC
coiled coil region 526 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117728
AA Change: N354S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113054
Gene: ENSMUSG00000027660
AA Change: N354S

DomainStartEndE-ValueType
Pfam:Ski_Sno 41 153 1.5e-45 PFAM
c-SKI_SMAD_bind 178 273 6.01e-64 SMART
low complexity region 347 357 N/A INTRINSIC
coiled coil region 400 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118204
AA Change: N480S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112413
Gene: ENSMUSG00000027660
AA Change: N480S

DomainStartEndE-ValueType
Pfam:Ski_Sno 125 232 2.7e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 419 437 N/A INTRINSIC
coiled coil region 526 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118470
AA Change: N434S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113256
Gene: ENSMUSG00000027660
AA Change: N434S

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 233 2e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 427 437 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 5e-3 SMART
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of a small family of proteins that play a key role in the response of cells to extracellular growth signals. The encoded protein regulates members of the transforming growth factor beta signaling pathway. It is highly expressed in certain cancer cells, where it may have both tumor-suppressing and tumor-promoting roles. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Heterozygotes for a null allele develop lymphomas and show increased incidence of chemically-induced tumors while homozygotes die before implantation. Homozygotes for a different null allele are viable but show defective T cell activation and impaired mammary gland alveologenesis and lactogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Skil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01940:Skil APN 3 31111644 missense probably benign 0.01
IGL02149:Skil APN 3 31097707 missense possibly damaging 0.47
IGL02388:Skil APN 3 31111638 nonsense probably null
IGL02478:Skil APN 3 31097819 nonsense probably null
IGL02723:Skil APN 3 31117524 missense probably damaging 1.00
PIT4243001:Skil UTSW 3 31113565 missense probably damaging 0.98
PIT4466001:Skil UTSW 3 31098232 missense probably damaging 1.00
PIT4472001:Skil UTSW 3 31098232 missense probably damaging 1.00
R1809:Skil UTSW 3 31117506 missense probably damaging 0.99
R3124:Skil UTSW 3 31097338 missense probably benign 0.03
R4865:Skil UTSW 3 31113413 missense probably damaging 1.00
R5213:Skil UTSW 3 31117451 missense probably damaging 0.99
R5328:Skil UTSW 3 31117569 missense probably benign 0.00
R5357:Skil UTSW 3 31113551 missense probably benign
R5428:Skil UTSW 3 31097498 missense probably benign
R6153:Skil UTSW 3 31097853 missense probably damaging 1.00
R6613:Skil UTSW 3 31097880 missense probably null 1.00
R7270:Skil UTSW 3 31097175 intron probably benign
R7999:Skil UTSW 3 31097602 missense possibly damaging 0.90
Z1176:Skil UTSW 3 31097526 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTTGTAGTTGTCACCTGGCAC -3'
(R):5'- CAGCTTACCATCTGCAGCTG -3'

Sequencing Primer
(F):5'- GTCACCTGGCACTACATTTATTTG -3'
(R):5'- GCAGAATGGAGTTCAGCTTCTCC -3'
Posted On2015-04-17