Incidental Mutation 'R3750:Kcnc4'
ID 310133
Institutional Source Beutler Lab
Gene Symbol Kcnc4
Ensembl Gene ENSMUSG00000027895
Gene Name potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms Kcr2-4, Kv3.4
MMRRC Submission 040735-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R3750 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 107438303-107459552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107448190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 314 (V314A)
Ref Sequence ENSEMBL: ENSMUSP00000009617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009617]
AlphaFold Q8R1C0
Predicted Effect probably benign
Transcript: ENSMUST00000009617
AA Change: V314A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000009617
Gene: ENSMUSG00000027895
AA Change: V314A

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 29 3e-23 PFAM
BTB 36 155 4.66e-16 SMART
low complexity region 168 185 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
Pfam:Ion_trans 229 487 2.6e-46 PFAM
Pfam:Ion_trans_2 386 480 3e-12 PFAM
low complexity region 489 505 N/A INTRINSIC
Meta Mutation Damage Score 0.2029 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Kcnc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnc4 APN 3 107447873 missense probably benign 0.01
IGL00899:Kcnc4 APN 3 107458463 missense possibly damaging 0.94
IGL01755:Kcnc4 APN 3 107448175 missense probably damaging 1.00
IGL01895:Kcnc4 APN 3 107448218 missense probably benign 0.01
IGL02741:Kcnc4 APN 3 107447978 missense probably damaging 0.98
IGL03393:Kcnc4 APN 3 107447927 missense possibly damaging 0.75
PIT4151001:Kcnc4 UTSW 3 107458703 missense probably damaging 1.00
PIT4378001:Kcnc4 UTSW 3 107447563 missense probably benign
R0158:Kcnc4 UTSW 3 107458604 missense probably benign 0.21
R0415:Kcnc4 UTSW 3 107445433 missense probably damaging 1.00
R0704:Kcnc4 UTSW 3 107447963 missense possibly damaging 0.92
R0747:Kcnc4 UTSW 3 107448154 missense probably damaging 1.00
R1481:Kcnc4 UTSW 3 107448218 missense probably benign 0.02
R1540:Kcnc4 UTSW 3 107445427 splice site probably null
R1602:Kcnc4 UTSW 3 107448204 missense possibly damaging 0.96
R2422:Kcnc4 UTSW 3 107445547 missense probably benign 0.30
R4791:Kcnc4 UTSW 3 107447543 missense probably benign 0.32
R4815:Kcnc4 UTSW 3 107458266 missense probably benign 0.37
R5216:Kcnc4 UTSW 3 107439441 missense probably benign
R5259:Kcnc4 UTSW 3 107448085 missense probably damaging 1.00
R5317:Kcnc4 UTSW 3 107458739 missense probably damaging 0.98
R5474:Kcnc4 UTSW 3 107447891 missense possibly damaging 0.82
R5783:Kcnc4 UTSW 3 107447872 missense possibly damaging 0.69
R5865:Kcnc4 UTSW 3 107458199 critical splice donor site probably null
R6228:Kcnc4 UTSW 3 107448377 missense probably damaging 0.99
R6536:Kcnc4 UTSW 3 107448196 missense possibly damaging 0.81
R7018:Kcnc4 UTSW 3 107458862 missense probably benign 0.00
R7319:Kcnc4 UTSW 3 107458784 missense probably benign 0.21
R7687:Kcnc4 UTSW 3 107458609 small insertion probably benign
R8436:Kcnc4 UTSW 3 107458768 missense probably damaging 0.96
R8707:Kcnc4 UTSW 3 107448133 missense possibly damaging 0.76
R8844:Kcnc4 UTSW 3 107448080 missense probably damaging 1.00
R8868:Kcnc4 UTSW 3 107448136 missense probably damaging 1.00
R9542:Kcnc4 UTSW 3 107458255 nonsense probably null
X0020:Kcnc4 UTSW 3 107447651 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATAAGCAACAGGAACTCATTAGTGC -3'
(R):5'- ACATTGACCGAAACGTGACG -3'

Sequencing Primer
(F):5'- ACAGGAACTCATTAGTGCTGGCC -3'
(R):5'- CGTGACGGAGATTCATCGG -3'
Posted On 2015-04-17