Incidental Mutation 'R3750:Rtca'
ID310134
Institutional Source Beutler Lab
Gene Symbol Rtca
Ensembl Gene ENSMUSG00000000339
Gene NameRNA 3'-terminal phosphate cyclase
Synonyms2310009A18Rik, Rtcd1
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116488963-116508208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116493001 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 327 (F327L)
Ref Sequence ENSEMBL: ENSMUSP00000000348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000348] [ENSMUST00000140677] [ENSMUST00000153005]
Predicted Effect probably benign
Transcript: ENSMUST00000000348
AA Change: F327L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000348
Gene: ENSMUSG00000000339
AA Change: F327L

DomainStartEndE-ValueType
Pfam:RTC 12 338 4.3e-89 PFAM
Pfam:RTC_insert 185 287 4.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124486
Predicted Effect probably benign
Transcript: ENSMUST00000140677
SMART Domains Protein: ENSMUSP00000117610
Gene: ENSMUSG00000000339

DomainStartEndE-ValueType
Pfam:RTC 8 51 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153005
SMART Domains Protein: ENSMUSP00000119463
Gene: ENSMUSG00000000339

DomainStartEndE-ValueType
Pfam:RTC 1 133 1.1e-27 PFAM
Pfam:RTC_insert 78 142 2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180969
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA 3'-phosphate cyclase family. The encoded protein plays a role in RNA metabolism by catalyzing the ATP-dependent conversion of the 3'-phosphate of RNA substrates to a 2',3'-cyclic phosphodiester. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit incomplete prenatal lethality and enhanced retinal ganglion cell axon regeneration after optic nerve crush injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Rtca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Rtca APN 3 116504461 missense probably damaging 0.96
IGL02793:Rtca APN 3 116493077 missense probably damaging 1.00
IGL03028:Rtca APN 3 116493092 unclassified probably benign
R1749:Rtca UTSW 3 116497644 missense possibly damaging 0.83
R1858:Rtca UTSW 3 116494115 missense probably benign 0.30
R2127:Rtca UTSW 3 116497674 missense possibly damaging 0.85
R3083:Rtca UTSW 3 116508025 start gained probably benign
R5493:Rtca UTSW 3 116499631 missense probably benign
R5502:Rtca UTSW 3 116489282 nonsense probably null
R5889:Rtca UTSW 3 116499583 missense possibly damaging 0.87
R6151:Rtca UTSW 3 116507827 missense probably benign 0.04
R6763:Rtca UTSW 3 116507749 critical splice donor site probably null
R8184:Rtca UTSW 3 116507824 missense probably benign 0.01
Z1176:Rtca UTSW 3 116489303 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTAATCGCCCAGTGTGTC -3'
(R):5'- GCATTTACCAAGCCACAGACTG -3'

Sequencing Primer
(F):5'- TAATCGCCCAGTGTGTCAGGAG -3'
(R):5'- CATACTCTCTGTTACTGTGTAAAGC -3'
Posted On2015-04-17