Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:Usp1'

310135

Institutional Source

Beutler Lab

Gene Symbol

Usp1

Ensembl Gene

ENSMUSG00000028560

Gene Name

ubiquitin specific peptidase 1

Synonyms

MMRRC Submission

040735-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.873) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98923810-98935543 bp(+) (GRCm38)

Type of Mutation

splice site (3138 bp from exon)

DNA Base Change (assembly)

C to T at 98934120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000030289] [ENSMUST00000075836] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000127417] [ENSMUST00000205650]

AlphaFold

Q8BJQ2

Predicted Effect

probably null
Transcript: ENSMUST00000030286

SMART Domains

Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

Domain	Start	End	E-Value	Type
Pfam:DUF3398	67	159	6.5e-30	PFAM
coiled coil region	367	394	N/A	INTRINSIC
low complexity region	493	504	N/A	INTRINSIC
Pfam:DOCK-C2	557	736	1.8e-51	PFAM
low complexity region	789	799	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	888	901	N/A	INTRINSIC
low complexity region	1135	1163	N/A	INTRINSIC
low complexity region	1350	1364	N/A	INTRINSIC
low complexity region	1543	1565	N/A	INTRINSIC
Pfam:DHR-2	1571	2095	1.4e-217	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000030289
AA Change: T557I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: T557I

Domain	Start	End	E-Value	Type
Pfam:UCH	80	616	9.2e-35	PFAM
Pfam:UCH_1	415	618	1.3e-11	PFAM
Pfam:UCH	723	781	3.9e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000075836

SMART Domains

Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

Domain	Start	End	E-Value	Type
Pfam:DUF3398	65	159	5.8e-34	PFAM
coiled coil region	367	394	N/A	INTRINSIC
low complexity region	493	504	N/A	INTRINSIC
Pfam:DOCK-C2	556	737	3.3e-58	PFAM
low complexity region	789	799	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	888	901	N/A	INTRINSIC
low complexity region	1105	1133	N/A	INTRINSIC
low complexity region	1320	1334	N/A	INTRINSIC
low complexity region	1513	1535	N/A	INTRINSIC
Pfam:Ded_cyto	1888	2065	6.5e-80	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091358
AA Change: T557I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: T557I

Domain	Start	End	E-Value	Type
Pfam:UCH	80	622	5e-39	PFAM
Pfam:UCH_1	346	613	2.8e-11	PFAM
low complexity region	765	779	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124466

Predicted Effect

probably benign
Transcript: ENSMUST00000125104

SMART Domains

Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560

Domain	Start	End	E-Value	Type
Pfam:UCH	37	150	4.1e-14	PFAM
Pfam:UCH_1	38	80	1.2e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000127417

SMART Domains

Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

Domain	Start	End	E-Value	Type
low complexity region	140	162	N/A	INTRINSIC
Pfam:Ded_cyto	517	694	3e-80	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000205650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206128

Meta Mutation Damage Score

0.2777

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Usp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Usp1	APN	4	98934581	splice site	probably null
IGL02692:Usp1	APN	4	98928960	missense	probably benign	0.00
R1782:Usp1	UTSW	4	98934198	missense	probably damaging	1.00
R1991:Usp1	UTSW	4	98934294	missense	probably benign	0.00
R1992:Usp1	UTSW	4	98934294	missense	probably benign	0.00
R2273:Usp1	UTSW	4	98929842	missense	probably damaging	1.00
R2274:Usp1	UTSW	4	98929842	missense	probably damaging	1.00
R2275:Usp1	UTSW	4	98929842	missense	probably damaging	1.00
R3886:Usp1	UTSW	4	98929736	missense	probably damaging	1.00
R4014:Usp1	UTSW	4	98934702	missense	probably damaging	1.00
R5141:Usp1	UTSW	4	98934209	missense	probably damaging	1.00
R5304:Usp1	UTSW	4	98934618	missense	probably benign
R5388:Usp1	UTSW	4	98931057	missense	probably benign
R5709:Usp1	UTSW	4	98931123	missense	probably damaging	0.99
R6035:Usp1	UTSW	4	98929845	missense	probably damaging	1.00
R6035:Usp1	UTSW	4	98929845	missense	probably damaging	1.00
R6592:Usp1	UTSW	4	98926519	missense	possibly damaging	0.86
R6956:Usp1	UTSW	4	98931006	missense	probably damaging	0.96
R7117:Usp1	UTSW	4	98928890	missense	possibly damaging	0.59
R7396:Usp1	UTSW	4	98926451	intron	probably benign
R7516:Usp1	UTSW	4	98934119	missense	probably damaging	1.00
R7590:Usp1	UTSW	4	98934252	missense	possibly damaging	0.67
R7828:Usp1	UTSW	4	98932307	missense	probably damaging	1.00
R8050:Usp1	UTSW	4	98928913	missense	probably benign	0.10
R8085:Usp1	UTSW	4	98928341	missense	probably damaging	1.00
R8298:Usp1	UTSW	4	98930899	missense	probably damaging	1.00
R8736:Usp1	UTSW	4	98932868	missense	probably damaging	1.00
R8801:Usp1	UTSW	4	98934611	missense	probably benign
R8844:Usp1	UTSW	4	98934780	missense	probably damaging	1.00
R8887:Usp1	UTSW	4	98930948	missense	probably benign	0.43
R8899:Usp1	UTSW	4	98931110	missense	probably damaging	1.00
R9063:Usp1	UTSW	4	98931152	missense	probably benign	0.00
R9275:Usp1	UTSW	4	98931341	missense	probably damaging	0.98
R9738:Usp1	UTSW	4	98931435	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTGCATTTTCCTCAGAATTGAAGC -3'
(R):5'- TCATCGTCGTAGTTCCCAGC -3'

Sequencing Primer
(F):5'- CTCAGAATTGAAGCCTTAGTTTGCC -3'
(R):5'- CAGTGGCTCTGGCTTACCTAG -3'

Posted On

2015-04-17