Incidental Mutation 'R3750:Gm12800'
ID310136
Institutional Source Beutler Lab
Gene Symbol Gm12800
Ensembl Gene ENSMUSG00000037028
Gene Namepredicted gene 12800
Synonyms
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101909121-101911908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101909876 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 107 (D107E)
Ref Sequence ENSEMBL: ENSMUSP00000075380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075999
AA Change: D107E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075380
Gene: ENSMUSG00000037028
AA Change: D107E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 206 410 9e-11 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Gm12800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Gm12800 APN 4 101910280 missense probably benign 0.02
IGL02683:Gm12800 APN 4 101910354 missense probably benign 0.00
IGL03403:Gm12800 APN 4 101909928 missense probably benign 0.40
R0833:Gm12800 UTSW 4 101910097 missense probably damaging 0.97
R1054:Gm12800 UTSW 4 101909164 missense probably benign 0.00
R1953:Gm12800 UTSW 4 101910115 missense probably benign
R2216:Gm12800 UTSW 4 101910060 missense probably damaging 0.99
R3746:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R3747:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R4931:Gm12800 UTSW 4 101909170 missense possibly damaging 0.47
R5102:Gm12800 UTSW 4 101909239 missense probably damaging 1.00
R5586:Gm12800 UTSW 4 101910120 missense probably benign 0.00
R5822:Gm12800 UTSW 4 101910243 missense probably damaging 1.00
R6395:Gm12800 UTSW 4 101909992 missense probably benign
R6904:Gm12800 UTSW 4 101910094 missense possibly damaging 0.86
R7544:Gm12800 UTSW 4 101911402 missense possibly damaging 0.56
R7768:Gm12800 UTSW 4 101911813 missense probably benign
R8342:Gm12800 UTSW 4 101910384 missense probably benign 0.01
Z1088:Gm12800 UTSW 4 101910186 missense probably benign 0.00
Z1088:Gm12800 UTSW 4 101909118 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGCTCATGCAGTGTTCTTGC -3'
(R):5'- CATTTTCAGACAGCATAGCCTCAC -3'

Sequencing Primer
(F):5'- CAGTGTTCTTGCCTGCCTGG -3'
(R):5'- CTGCTGGGCCCATTGTAGAAAG -3'
Posted On2015-04-17