Incidental Mutation 'R3750:Clcn6'
ID310138
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Namechloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148004259-148038821 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 148024187 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 128 (C128*)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000131232] [ENSMUST00000137724]
Predicted Effect probably null
Transcript: ENSMUST00000030879
AA Change: C125*
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: C125*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105711
AA Change: C128*
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: C128*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131232
SMART Domains Protein: ENSMUSP00000116153
Gene: ENSMUSG00000029016

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134377
Predicted Effect probably null
Transcript: ENSMUST00000137724
AA Change: C128*
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: C128*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148017902 critical splice donor site probably null
IGL00434:Clcn6 APN 4 148013738 missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148013788 splice site probably benign
IGL01384:Clcn6 APN 4 148018966 missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148021451 splice site probably benign
IGL01522:Clcn6 APN 4 148017535 missense probably benign 0.44
R0194:Clcn6 UTSW 4 148012756 missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148008715 missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148024194 missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148014606 missense probably damaging 1.00
R0586:Clcn6 UTSW 4 148038749 unclassified probably benign
R0927:Clcn6 UTSW 4 148029392 missense probably benign 0.30
R1141:Clcn6 UTSW 4 148013899 missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148024156 missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148012778 missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148012769 missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148014594 missense probably benign
R1596:Clcn6 UTSW 4 148023379 missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148017568 missense probably benign 0.00
R1769:Clcn6 UTSW 4 148014301 splice site probably null
R2021:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2022:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2049:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148011068 missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148014600 missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148017494 critical splice donor site probably null
R2891:Clcn6 UTSW 4 148012616 critical splice donor site probably null
R4014:Clcn6 UTSW 4 148017610 missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148024167 missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148019766 missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148008770 missense probably benign 0.05
R5140:Clcn6 UTSW 4 148038317 unclassified probably benign
R5345:Clcn6 UTSW 4 148038749 unclassified probably benign
R5467:Clcn6 UTSW 4 148017636 missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148014561 missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148014189 missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148017592 missense probably benign 0.01
R6043:Clcn6 UTSW 4 148008788 missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148017500 missense probably benign 0.01
R6593:Clcn6 UTSW 4 148010769 missense probably benign 0.21
R7440:Clcn6 UTSW 4 148014195 missense probably damaging 1.00
R7674:Clcn6 UTSW 4 148012694 missense probably damaging 1.00
R7756:Clcn6 UTSW 4 148029439 missense probably damaging 1.00
R7901:Clcn6 UTSW 4 148010745 missense probably damaging 1.00
V7732:Clcn6 UTSW 4 148013955 missense probably damaging 0.96
Z1177:Clcn6 UTSW 4 148023370 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTTTCCTAACACATAGCTG -3'
(R):5'- AGTTCTAGGACAGCCAAGGC -3'

Sequencing Primer
(F):5'- TCAAGGCCAGCAGGATTAGTTTC -3'
(R):5'- CCAAGGCGACAGAGAAAGAC -3'
Posted On2015-04-17