Incidental Mutation 'R3750:Clcn6'
ID 310138
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Name chloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 040735-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R3750 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 148088716-148123270 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 148108644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 128 (C128*)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000131232] [ENSMUST00000137724]
AlphaFold O35454
Predicted Effect probably null
Transcript: ENSMUST00000030879
AA Change: C125*
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: C125*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105711
AA Change: C128*
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: C128*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131232
SMART Domains Protein: ENSMUSP00000116153
Gene: ENSMUSG00000029016

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134377
Predicted Effect probably null
Transcript: ENSMUST00000137724
AA Change: C128*
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: C128*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,036,501 (GRCm39) E347* probably null Het
Adam12 T C 7: 133,774,594 (GRCm39) D5G probably damaging Het
Adam26b A C 8: 43,974,234 (GRCm39) V256G probably benign Het
Ago1 A G 4: 126,354,837 (GRCm39) I125T probably benign Het
Bckdk C A 7: 127,504,590 (GRCm39) R105S probably damaging Het
Bub1b T A 2: 118,445,936 (GRCm39) N319K possibly damaging Het
Col6a4 C A 9: 105,897,864 (GRCm39) probably null Het
Cyp4v3 G A 8: 45,768,745 (GRCm39) R272* probably null Het
Dlg5 G A 14: 24,215,328 (GRCm39) A665V probably damaging Het
Foxd1 G C 13: 98,492,424 (GRCm39) A433P unknown Het
Hsd17b3 A T 13: 64,210,993 (GRCm39) probably null Het
Kcnc4 A G 3: 107,355,506 (GRCm39) V314A probably benign Het
Lrba T G 3: 86,283,260 (GRCm39) L1858R probably damaging Het
Marcks G A 10: 37,016,866 (GRCm39) probably benign Het
Mroh2b G A 15: 4,981,728 (GRCm39) W1513* probably null Het
Nefh A G 11: 4,889,937 (GRCm39) V894A probably benign Het
Pdzph1 A T 17: 59,280,331 (GRCm39) Y650* probably null Het
Plce1 A C 19: 38,766,343 (GRCm39) I2109L probably benign Het
Pramel18 T A 4: 101,767,073 (GRCm39) D107E possibly damaging Het
Primpol A T 8: 47,052,848 (GRCm39) D154E probably benign Het
Relch C T 1: 105,681,302 (GRCm39) T1178I probably damaging Het
Rtca A T 3: 116,286,650 (GRCm39) F327L probably benign Het
Scn2a T G 2: 65,544,115 (GRCm39) V832G probably damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Skil A G 3: 31,170,983 (GRCm39) N354S probably benign Het
Slk T G 19: 47,608,248 (GRCm39) D400E possibly damaging Het
Spata31 G T 13: 65,069,557 (GRCm39) L568F probably benign Het
Spon1 T C 7: 113,365,621 (GRCm39) L19P probably damaging Het
Spon1 T A 7: 113,616,024 (GRCm39) V297E possibly damaging Het
Tas2r136 A T 6: 132,754,200 (GRCm39) F309Y probably damaging Het
Tcp11l1 A G 2: 104,528,887 (GRCm39) I137T probably damaging Het
Ttn G A 2: 76,584,350 (GRCm39) H22253Y probably damaging Het
Upf1 G T 8: 70,786,000 (GRCm39) N975K possibly damaging Het
Usp1 C T 4: 98,822,357 (GRCm39) probably null Het
Zfhx4 G A 3: 5,308,225 (GRCm39) E484K possibly damaging Het
Zswim4 G A 8: 84,938,676 (GRCm39) P1069S possibly damaging Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148,102,359 (GRCm39) critical splice donor site probably null
IGL00434:Clcn6 APN 4 148,098,195 (GRCm39) missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148,098,245 (GRCm39) splice site probably benign
IGL01384:Clcn6 APN 4 148,103,423 (GRCm39) missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148,105,908 (GRCm39) splice site probably benign
IGL01522:Clcn6 APN 4 148,101,992 (GRCm39) missense probably benign 0.44
R0194:Clcn6 UTSW 4 148,097,213 (GRCm39) missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148,093,172 (GRCm39) missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148,108,651 (GRCm39) missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148,099,063 (GRCm39) missense probably damaging 1.00
R0586:Clcn6 UTSW 4 148,123,206 (GRCm39) unclassified probably benign
R0927:Clcn6 UTSW 4 148,113,849 (GRCm39) missense probably benign 0.30
R1141:Clcn6 UTSW 4 148,098,356 (GRCm39) missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148,098,358 (GRCm39) missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148,098,358 (GRCm39) missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148,108,613 (GRCm39) missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148,097,235 (GRCm39) missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148,097,226 (GRCm39) missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148,099,051 (GRCm39) missense probably benign
R1596:Clcn6 UTSW 4 148,107,836 (GRCm39) missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148,102,025 (GRCm39) missense probably benign 0.00
R1769:Clcn6 UTSW 4 148,098,758 (GRCm39) splice site probably null
R2021:Clcn6 UTSW 4 148,095,109 (GRCm39) critical splice donor site probably null
R2022:Clcn6 UTSW 4 148,095,109 (GRCm39) critical splice donor site probably null
R2049:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148,095,525 (GRCm39) missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148,099,057 (GRCm39) missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148,101,951 (GRCm39) critical splice donor site probably null
R2891:Clcn6 UTSW 4 148,097,073 (GRCm39) critical splice donor site probably null
R4014:Clcn6 UTSW 4 148,102,067 (GRCm39) missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148,108,624 (GRCm39) missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148,104,223 (GRCm39) missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148,093,227 (GRCm39) missense probably benign 0.05
R5140:Clcn6 UTSW 4 148,122,774 (GRCm39) unclassified probably benign
R5345:Clcn6 UTSW 4 148,123,206 (GRCm39) unclassified probably benign
R5467:Clcn6 UTSW 4 148,102,093 (GRCm39) missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148,099,018 (GRCm39) missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148,098,646 (GRCm39) missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148,102,049 (GRCm39) missense probably benign 0.01
R6043:Clcn6 UTSW 4 148,093,245 (GRCm39) missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148,101,957 (GRCm39) missense probably benign 0.01
R6593:Clcn6 UTSW 4 148,095,226 (GRCm39) missense probably benign 0.21
R7440:Clcn6 UTSW 4 148,098,652 (GRCm39) missense probably damaging 1.00
R7674:Clcn6 UTSW 4 148,097,151 (GRCm39) missense probably damaging 1.00
R7756:Clcn6 UTSW 4 148,113,896 (GRCm39) missense probably damaging 1.00
R7901:Clcn6 UTSW 4 148,095,202 (GRCm39) missense probably damaging 1.00
R8559:Clcn6 UTSW 4 148,111,032 (GRCm39) missense possibly damaging 0.88
R8747:Clcn6 UTSW 4 148,093,354 (GRCm39) critical splice donor site probably null
R9246:Clcn6 UTSW 4 148,113,866 (GRCm39) missense probably benign 0.25
R9343:Clcn6 UTSW 4 148,098,458 (GRCm39) missense probably benign 0.03
V7732:Clcn6 UTSW 4 148,098,412 (GRCm39) missense probably damaging 0.96
Z1177:Clcn6 UTSW 4 148,107,827 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTTTCCTAACACATAGCTG -3'
(R):5'- AGTTCTAGGACAGCCAAGGC -3'

Sequencing Primer
(F):5'- TCAAGGCCAGCAGGATTAGTTTC -3'
(R):5'- CCAAGGCGACAGAGAAAGAC -3'
Posted On 2015-04-17