Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:Clcn6'

310138

Institutional Source

Beutler Lab

Gene Symbol

Clcn6

Ensembl Gene

ENSMUSG00000029016

Gene Name

chloride channel, voltage-sensitive 6

Synonyms

MMRRC Submission

040735-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148004259-148038821 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 148024187 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 128 (C128*)

Ref Sequence

ENSEMBL: ENSMUSP00000121751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000131232] [ENSMUST00000137724]

AlphaFold

O35454

Predicted Effect

probably null
Transcript: ENSMUST00000030879
AA Change: C125*

SMART Domains

Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: C125*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	138	571	5.5e-98	PFAM
CBS	609	658	1.68e-3	SMART
CBS	811	859	1.34e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105711
AA Change: C128*

SMART Domains

Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: C128*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.5e-98	PFAM
CBS	612	661	1.68e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131232

SMART Domains

Protein: ENSMUSP00000116153
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
transmembrane domain	27	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134377

Predicted Effect

probably null
Transcript: ENSMUST00000137724
AA Change: C128*

SMART Domains

Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: C128*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.9e-101	PFAM
CBS	612	661	1.68e-3	SMART
CBS	814	862	1.34e-11	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Clcn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Clcn6	APN	4	148017902	critical splice donor site	probably null
IGL00434:Clcn6	APN	4	148013738	missense	probably damaging	1.00
IGL00973:Clcn6	APN	4	148013788	splice site	probably benign
IGL01384:Clcn6	APN	4	148018966	missense	probably damaging	1.00
IGL01465:Clcn6	APN	4	148021451	splice site	probably benign
IGL01522:Clcn6	APN	4	148017535	missense	probably benign	0.44
R0194:Clcn6	UTSW	4	148012756	missense	probably damaging	1.00
R0280:Clcn6	UTSW	4	148008715	missense	probably damaging	1.00
R0349:Clcn6	UTSW	4	148024194	missense	possibly damaging	0.89
R0352:Clcn6	UTSW	4	148014606	missense	probably damaging	1.00
R0586:Clcn6	UTSW	4	148038749	unclassified	probably benign
R0927:Clcn6	UTSW	4	148029392	missense	probably benign	0.30
R1141:Clcn6	UTSW	4	148013899	missense	probably damaging	0.99
R1465:Clcn6	UTSW	4	148013901	missense	probably damaging	1.00
R1465:Clcn6	UTSW	4	148013901	missense	probably damaging	1.00
R1473:Clcn6	UTSW	4	148024156	missense	possibly damaging	0.93
R1551:Clcn6	UTSW	4	148012778	missense	possibly damaging	0.74
R1571:Clcn6	UTSW	4	148012769	missense	possibly damaging	0.63
R1593:Clcn6	UTSW	4	148014594	missense	probably benign
R1596:Clcn6	UTSW	4	148023379	missense	probably damaging	1.00
R1706:Clcn6	UTSW	4	148017568	missense	probably benign	0.00
R1769:Clcn6	UTSW	4	148014301	splice site	probably null
R2021:Clcn6	UTSW	4	148010652	critical splice donor site	probably null
R2022:Clcn6	UTSW	4	148010652	critical splice donor site	probably null
R2049:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2081:Clcn6	UTSW	4	148011068	missense	probably damaging	1.00
R2140:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2141:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2142:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2177:Clcn6	UTSW	4	148014600	missense	possibly damaging	0.73
R2511:Clcn6	UTSW	4	148017494	critical splice donor site	probably null
R2891:Clcn6	UTSW	4	148012616	critical splice donor site	probably null
R4014:Clcn6	UTSW	4	148017610	missense	probably damaging	0.98
R4023:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4024:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4025:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4667:Clcn6	UTSW	4	148024167	missense	possibly damaging	0.61
R4865:Clcn6	UTSW	4	148019766	missense	probably damaging	1.00
R4978:Clcn6	UTSW	4	148008770	missense	probably benign	0.05
R5140:Clcn6	UTSW	4	148038317	unclassified	probably benign
R5345:Clcn6	UTSW	4	148038749	unclassified	probably benign
R5467:Clcn6	UTSW	4	148017636	missense	possibly damaging	0.81
R5665:Clcn6	UTSW	4	148014561	missense	possibly damaging	0.71
R5739:Clcn6	UTSW	4	148014189	missense	probably damaging	1.00
R5899:Clcn6	UTSW	4	148017592	missense	probably benign	0.01
R6043:Clcn6	UTSW	4	148008788	missense	probably damaging	1.00
R6351:Clcn6	UTSW	4	148017500	missense	probably benign	0.01
R6593:Clcn6	UTSW	4	148010769	missense	probably benign	0.21
R7440:Clcn6	UTSW	4	148014195	missense	probably damaging	1.00
R7674:Clcn6	UTSW	4	148012694	missense	probably damaging	1.00
R7756:Clcn6	UTSW	4	148029439	missense	probably damaging	1.00
R7901:Clcn6	UTSW	4	148010745	missense	probably damaging	1.00
R8559:Clcn6	UTSW	4	148026575	missense	possibly damaging	0.88
R8747:Clcn6	UTSW	4	148008897	critical splice donor site	probably null
R9246:Clcn6	UTSW	4	148029409	missense	probably benign	0.25
R9343:Clcn6	UTSW	4	148014001	missense	probably benign	0.03
V7732:Clcn6	UTSW	4	148013955	missense	probably damaging	0.96
Z1177:Clcn6	UTSW	4	148023370	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTGTTTCCTAACACATAGCTG -3'
(R):5'- AGTTCTAGGACAGCCAAGGC -3'

Sequencing Primer
(F):5'- TCAAGGCCAGCAGGATTAGTTTC -3'
(R):5'- CCAAGGCGACAGAGAAAGAC -3'

Posted On

2015-04-17