Incidental Mutation 'R0382:Lrp6'
ID31014
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134467668 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1080 (S1080P)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
Predicted Effect probably damaging
Transcript: ENSMUST00000032322
AA Change: S1080P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: S1080P

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111950
SMART Domains Protein: ENSMUSP00000107581
Gene: ENSMUSG00000030201

DomainStartEndE-ValueType
LY 11 53 1.41e-5 SMART
LY 59 102 5.32e-1 SMART
LY 103 147 5e-6 SMART
LY 148 190 4.25e-9 SMART
LY 191 231 1.91e-2 SMART
EGF 260 304 1.23e1 SMART
LDLa 302 341 2.42e-12 SMART
LDLa 342 378 4.37e-10 SMART
LDLa 379 416 1.66e-10 SMART
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 483 492 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 620 627 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203773
Meta Mutation Damage Score 0.4166 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4521:Lrp6 UTSW 6 134485862 missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134511267 missense probably benign
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R5508:Lrp6 UTSW 6 134464516 missense probably benign 0.31
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134507558 nonsense probably null
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134507551 missense probably benign
R7266:Lrp6 UTSW 6 134507401 missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134450960 nonsense probably null
R7366:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7368:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134486508 missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134507508 missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134511245 nonsense probably null
R7771:Lrp6 UTSW 6 134462616 missense probably damaging 1.00
Z1176:Lrp6 UTSW 6 134456157 missense not run
Z1177:Lrp6 UTSW 6 134462541 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGATCACTGCTTTCAATTCGCCG -3'
(R):5'- TGCCTGGGAGACTGACTGACTG -3'

Sequencing Primer
(F):5'- AATTCGCCGGAGATCTGAGTC -3'
(R):5'- CCCCTGAGGAGATAGAGATACTTAAC -3'
Posted On2013-04-24