Mutagenetix > Incidental Mutations

Incidental Mutation 'R0382:Lrp6'

31014

Institutional Source

Beutler Lab

Gene Symbol

Lrp6

Ensembl Gene

ENSMUSG00000030201

Gene Name

low density lipoprotein receptor-related protein 6

Synonyms

skax26, Cd, ska26, ska

MMRRC Submission

038588-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R0382 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134446476-134566965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 134467668 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1080 (S1080P)

Ref Sequence

ENSEMBL: ENSMUSP00000032322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032322]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032322
AA Change: S1080P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: S1080P

Domain	Start	End	E-Value	Type
LY	43	85	1.55e-2	SMART
LY	87	129	1.91e-11	SMART
LY	130	173	5.19e-13	SMART
LY	174	216	1.39e-13	SMART
LY	217	258	2.87e-6	SMART
EGF	285	324	2.16e-1	SMART
low complexity region	330	341	N/A	INTRINSIC
LY	352	394	1.29e-8	SMART
LY	395	437	5.73e-15	SMART
LY	438	481	1.07e-14	SMART
LY	482	524	3.07e-15	SMART
LY	525	565	4.66e-6	SMART
EGF	591	628	1.47e-3	SMART
LY	654	696	2.06e-7	SMART
LY	697	739	3.73e-14	SMART
LY	740	783	3.37e-12	SMART
LY	784	825	1.17e-6	SMART
LY	827	865	1.91e-2	SMART
EGF	892	930	7.35e-4	SMART
LY	957	999	1.41e-5	SMART
LY	1005	1048	5.32e-1	SMART
LY	1049	1093	5e-6	SMART
LY	1094	1136	4.25e-9	SMART
LY	1137	1177	1.91e-2	SMART
EGF	1206	1250	1.23e1	SMART
LDLa	1248	1287	2.42e-12	SMART
LDLa	1288	1324	4.37e-10	SMART
LDLa	1325	1362	1.66e-10	SMART
transmembrane domain	1371	1393	N/A	INTRINSIC
low complexity region	1429	1438	N/A	INTRINSIC
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1566	1573	N/A	INTRINSIC
low complexity region	1596	1608	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111950

SMART Domains

Protein: ENSMUSP00000107581
Gene: ENSMUSG00000030201

Domain	Start	End	E-Value	Type
LY	11	53	1.41e-5	SMART
LY	59	102	5.32e-1	SMART
LY	103	147	5e-6	SMART
LY	148	190	4.25e-9	SMART
LY	191	231	1.91e-2	SMART
EGF	260	304	1.23e1	SMART
LDLa	302	341	2.42e-12	SMART
LDLa	342	378	4.37e-10	SMART
LDLa	379	416	1.66e-10	SMART
transmembrane domain	425	447	N/A	INTRINSIC
low complexity region	483	492	N/A	INTRINSIC
low complexity region	498	511	N/A	INTRINSIC
low complexity region	562	578	N/A	INTRINSIC
low complexity region	620	627	N/A	INTRINSIC
low complexity region	650	662	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203016

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203773

Meta Mutation Damage Score

0.4166

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	A	T	6: 86,946,919	Q266L	probably benign	Het
Abca13	T	C	11: 9,636,650		probably benign	Het
Adap2	T	C	11: 80,178,385		probably benign	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Brinp1	T	C	4: 68,762,308	R662G	possibly damaging	Het
Celsr3	C	A	9: 108,829,218	P967T	probably damaging	Het
Ces1b	T	C	8: 93,076,052		probably benign	Het
Ckm	T	C	7: 19,421,384	*382Q	probably null	Het
Clec14a	A	G	12: 58,268,617	V73A	probably damaging	Het
Cmya5	A	T	13: 93,092,748	V1944E	probably benign	Het
Col6a6	T	A	9: 105,755,555	D1473V	probably damaging	Het
Cttnbp2	A	G	6: 18,435,343	M172T	probably benign	Het
Dcaf12	T	C	4: 41,302,672	N161S	probably damaging	Het
Dnah17	T	C	11: 118,128,996	Y75C	probably damaging	Het
Efcab7	T	C	4: 99,901,769	V388A	possibly damaging	Het
Fat3	A	G	9: 15,959,756	C3780R	probably damaging	Het
Fbxl14	T	C	6: 119,481,060	*401R	probably null	Het
Fbxo5	G	T	10: 5,801,176	Y270*	probably null	Het
Fnbp1l	A	T	3: 122,570,953		probably benign	Het
Fstl3	T	C	10: 79,777,307	S3P	probably benign	Het
Gpatch1	T	C	7: 35,301,655	D309G	probably damaging	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Klk6	A	G	7: 43,829,245	D192G	probably benign	Het
Lztfl1	T	C	9: 123,707,906		probably null	Het
Mov10l1	A	G	15: 88,985,593	Y59C	possibly damaging	Het
Natd1	C	T	11: 60,906,913	R62H	probably damaging	Het
Obscn	T	C	11: 59,040,306	T5835A	probably damaging	Het
Olfr1052	A	G	2: 86,298,593	Y259C	probably damaging	Het
Olfr1183	A	T	2: 88,461,725	R147S	possibly damaging	Het
Olfr1354	T	A	10: 78,917,126	Y95*	probably null	Het
Olfr792	T	C	10: 129,541,014	I159T	probably benign	Het
P2rx2	T	A	5: 110,341,179	E289V	probably benign	Het
Patl1	T	A	19: 11,925,232		probably null	Het
Ptprf	A	G	4: 118,223,394		probably benign	Het
Qrfpr	C	T	3: 36,180,969	C253Y	possibly damaging	Het
Rad21l	A	T	2: 151,645,443	D540E	probably damaging	Het
Rbm45	T	A	2: 76,370,211	I28N	possibly damaging	Het
Rnf170	A	T	8: 26,125,899		probably benign	Het
Sgsm3	G	A	15: 81,008,314	W280*	probably null	Het
Slc9a9	A	T	9: 94,685,217	H113L	probably benign	Het
Slc9b2	G	T	3: 135,318,422	C78F	probably damaging	Het
Slfn10-ps	T	A	11: 83,029,534		noncoding transcript	Het
Slfn8	T	A	11: 83,004,556	I475F	probably damaging	Het
Stox2	A	G	8: 47,203,284		probably benign	Het
Strbp	A	T	2: 37,600,826	N472K	probably benign	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tmem39a	A	G	16: 38,591,398		probably benign	Het
Trpc4ap	A	G	2: 155,636,230	L664P	probably damaging	Het
Uap1	T	A	1: 170,161,482	M124L	probably benign	Het
Usp48	A	G	4: 137,621,218	N536S	probably benign	Het
Usp50	T	A	2: 126,777,928	I155F	probably damaging	Het
Utp4	T	C	8: 106,922,935	I672T	probably benign	Het
Vmn1r94	A	T	7: 20,167,653	M242K	possibly damaging	Het
Vmn2r45	T	G	7: 8,483,099	N397H	probably benign	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vps41	C	A	13: 18,827,727	H335N	probably benign	Het

Other mutations in Lrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Lrp6	APN	6	134456090	missense	probably benign	0.17
IGL00765:Lrp6	APN	6	134541854	missense	probably benign	0.02
IGL00898:Lrp6	APN	6	134479739	missense	probably damaging	0.99
IGL00916:Lrp6	APN	6	134484289	missense	probably damaging	1.00
IGL00961:Lrp6	APN	6	134507646	missense	probably damaging	0.98
IGL01620:Lrp6	APN	6	134511262	missense	probably damaging	1.00
IGL01765:Lrp6	APN	6	134456145	missense	probably damaging	0.99
IGL02066:Lrp6	APN	6	134450937	nonsense	probably null
IGL02067:Lrp6	APN	6	134480396	missense	probably damaging	0.99
IGL02169:Lrp6	APN	6	134513327	missense	probably damaging	0.96
IGL02281:Lrp6	APN	6	134457734	missense	probably benign	0.40
IGL02484:Lrp6	APN	6	134541923	missense	probably benign	0.15
IGL02724:Lrp6	APN	6	134484265	missense	probably damaging	1.00
IGL02876:Lrp6	APN	6	134456114	missense	probably benign	0.43
IGL03011:Lrp6	APN	6	134520417	missense	possibly damaging	0.80
IGL03352:Lrp6	APN	6	134479763	missense	probably damaging	1.00
Coiled	UTSW	6	134507558	nonsense	probably null
BB004:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
BB014:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
PIT4494001:Lrp6	UTSW	6	134479778	missense	probably damaging	1.00
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0201:Lrp6	UTSW	6	134450897	nonsense	probably null
R0295:Lrp6	UTSW	6	134457693	missense	probably benign	0.02
R0370:Lrp6	UTSW	6	134479766	missense	probably damaging	1.00
R0413:Lrp6	UTSW	6	134507624	missense	probably damaging	0.99
R0468:Lrp6	UTSW	6	134485661	missense	possibly damaging	0.94
R0492:Lrp6	UTSW	6	134480518	missense	possibly damaging	0.58
R0584:Lrp6	UTSW	6	134456076	missense	probably damaging	0.99
R0631:Lrp6	UTSW	6	134479775	missense	possibly damaging	0.95
R0738:Lrp6	UTSW	6	134542045	missense	probably benign	0.13
R0907:Lrp6	UTSW	6	134507525	missense	probably damaging	0.96
R1273:Lrp6	UTSW	6	134467507	critical splice donor site	probably null
R1548:Lrp6	UTSW	6	134459429	missense	possibly damaging	0.89
R1639:Lrp6	UTSW	6	134453566	missense	possibly damaging	0.68
R1650:Lrp6	UTSW	6	134468769	missense	probably benign	0.01
R1696:Lrp6	UTSW	6	134468723	missense	probably damaging	1.00
R1751:Lrp6	UTSW	6	134464568	missense	probably damaging	1.00
R1780:Lrp6	UTSW	6	134464451	missense	probably damaging	0.99
R2013:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2015:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2165:Lrp6	UTSW	6	134459283	missense	probably damaging	1.00
R2294:Lrp6	UTSW	6	134457742	missense	probably damaging	1.00
R2336:Lrp6	UTSW	6	134507583	missense	probably damaging	0.97
R2964:Lrp6	UTSW	6	134467526	missense	probably damaging	1.00
R3716:Lrp6	UTSW	6	134507447	missense	probably damaging	1.00
R4017:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R4370:Lrp6	UTSW	6	134506358	nonsense	probably null
R4521:Lrp6	UTSW	6	134485862	missense	probably damaging	1.00
R4573:Lrp6	UTSW	6	134470730	nonsense	probably null
R4645:Lrp6	UTSW	6	134484250	missense	probably damaging	1.00
R4661:Lrp6	UTSW	6	134511267	missense	probably benign
R4688:Lrp6	UTSW	6	134479743	missense	probably damaging	1.00
R4784:Lrp6	UTSW	6	134479539	missense	probably benign	0.06
R5236:Lrp6	UTSW	6	134511264	missense	probably damaging	1.00
R5506:Lrp6	UTSW	6	134459296	missense	probably benign	0.09
R5508:Lrp6	UTSW	6	134464516	missense	probably benign	0.31
R6001:Lrp6	UTSW	6	134464518	missense	probably benign	0.03
R6319:Lrp6	UTSW	6	134541835	missense	possibly damaging	0.46
R6537:Lrp6	UTSW	6	134480495	missense	probably benign
R6552:Lrp6	UTSW	6	134454729	missense	probably benign	0.17
R6559:Lrp6	UTSW	6	134513254	missense	probably damaging	1.00
R6575:Lrp6	UTSW	6	134541971	missense	possibly damaging	0.80
R6585:Lrp6	UTSW	6	134507558	nonsense	probably null
R6700:Lrp6	UTSW	6	134479560	missense	probably damaging	1.00
R6724:Lrp6	UTSW	6	134486541	missense	possibly damaging	0.94
R7159:Lrp6	UTSW	6	134507551	missense	probably benign
R7266:Lrp6	UTSW	6	134507401	missense	probably damaging	1.00
R7339:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7341:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7342:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7348:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7359:Lrp6	UTSW	6	134450960	nonsense	probably null
R7366:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7368:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7501:Lrp6	UTSW	6	134486508	missense	probably damaging	1.00
R7548:Lrp6	UTSW	6	134507508	missense	probably damaging	0.97
R7652:Lrp6	UTSW	6	134511245	nonsense	probably null
R7771:Lrp6	UTSW	6	134462616	missense	probably damaging	1.00
R7927:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
Z1176:Lrp6	UTSW	6	134456157	missense	possibly damaging	0.72
Z1177:Lrp6	UTSW	6	134462541	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGATCACTGCTTTCAATTCGCCG -3'
(R):5'- TGCCTGGGAGACTGACTGACTG -3'

Sequencing Primer
(F):5'- AATTCGCCGGAGATCTGAGTC -3'
(R):5'- CCCCTGAGGAGATAGAGATACTTAAC -3'

Posted On

2013-04-24