Incidental Mutation 'R3750:Tas2r136'
ID310140
Institutional Source Beutler Lab
Gene Symbol Tas2r136
Ensembl Gene ENSMUSG00000053217
Gene Nametaste receptor, type 2, member 136
SynonymsTas2r36, mt2r52
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132777179-132778162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132777237 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 309 (F309Y)
Ref Sequence ENSEMBL: ENSMUSP00000070791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065532]
Predicted Effect probably damaging
Transcript: ENSMUST00000065532
AA Change: F309Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070791
Gene: ENSMUSG00000053217
AA Change: F309Y

DomainStartEndE-ValueType
Pfam:TAS2R 23 317 8.4e-68 PFAM
Meta Mutation Damage Score 0.2471 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAS2R44 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Tas2r136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tas2r136 APN 6 132777198 missense probably damaging 1.00
IGL02414:Tas2r136 APN 6 132777531 missense possibly damaging 0.87
IGL02662:Tas2r136 APN 6 132777708 missense probably damaging 1.00
R0607:Tas2r136 UTSW 6 132777412 missense probably benign 0.09
R0785:Tas2r136 UTSW 6 132777927 missense probably benign
R1727:Tas2r136 UTSW 6 132777790 missense possibly damaging 0.63
R2101:Tas2r136 UTSW 6 132777532 missense probably benign 0.09
R2975:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3080:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3746:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R3749:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R4362:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4411:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4413:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4803:Tas2r136 UTSW 6 132777492 missense probably damaging 1.00
R5283:Tas2r136 UTSW 6 132777411 missense probably damaging 0.99
R5343:Tas2r136 UTSW 6 132778080 missense probably benign 0.00
R5738:Tas2r136 UTSW 6 132777744 missense probably damaging 1.00
R5872:Tas2r136 UTSW 6 132777331 missense possibly damaging 0.46
R6770:Tas2r136 UTSW 6 132777382 missense probably benign 0.03
R7326:Tas2r136 UTSW 6 132777906 missense possibly damaging 0.65
R7845:Tas2r136 UTSW 6 132777870 missense probably benign 0.05
R7900:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
R8422:Tas2r136 UTSW 6 132777327 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTATGCCTGGCTTCATAATTCTG -3'
(R):5'- CAACCCACATTAAGGTTTTGCAAG -3'

Sequencing Primer
(F):5'- GCCTGGCTTCATAATTCTGAAAAATG -3'
(R):5'- CCCACATTAAGGTTTTGCAAGTTTTG -3'
Posted On2015-04-17