Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:Bckdk'

310144

Institutional Source

Beutler Lab

Gene Symbol

Bckdk

Ensembl Gene

ENSMUSG00000030802

Gene Name

branched chain ketoacid dehydrogenase kinase

Synonyms

BCKD-kinase

MMRRC Submission

040735-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127904082-127910221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 127905418 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 105 (R105S)

Ref Sequence

ENSEMBL: ENSMUSP00000146303 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071056] [ENSMUST00000124533] [ENSMUST00000151451] [ENSMUST00000206140] [ENSMUST00000206745]

AlphaFold

O55028

Predicted Effect

probably damaging
Transcript: ENSMUST00000071056
AA Change: R105S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070345
Gene: ENSMUSG00000030802
AA Change: R105S

Domain	Start	End	E-Value	Type
low complexity region	7	35	N/A	INTRINSIC
Pfam:BCDHK_Adom3	69	222	1.8e-44	PFAM
HATPase_c	264	404	2.06e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124533
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146574

Predicted Effect

probably damaging
Transcript: ENSMUST00000151451
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116990
Gene: ENSMUSG00000030802
AA Change: R105S

Domain	Start	End	E-Value	Type
low complexity region	7	35	N/A	INTRINSIC
Pfam:BCDHK_Adom3	68	214	1.4e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000206068

Predicted Effect

probably damaging
Transcript: ENSMUST00000206140
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206745
AA Change: R105S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.9536

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Nullizygous mutations lead to altered amino acid metabolism, gait anomalies and neurobehavioral phenotypes. Homozygotes for a gene trapped allele show impaired growth, reduced fertility and epileptic seizures. Homozygotes for another gene trapped allele show motor delay and autism-like behaviors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Bckdk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01620:Bckdk	APN	7	127905776	missense	possibly damaging	0.67
IGL02176:Bckdk	APN	7	127906373	missense	probably benign	0.31
IGL02444:Bckdk	APN	7	127907446	missense	probably damaging	1.00
daft	UTSW	7	127908010	missense	probably benign	0.04
dottie	UTSW	7	127906400	nonsense	probably null
morse	UTSW	7	127907486	missense	probably null	0.94
Squished	UTSW	7	127905418	missense	probably damaging	1.00
R2105:Bckdk	UTSW	7	127907317	missense	probably damaging	1.00
R2240:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R2252:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R2474:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R3696:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R3697:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R3747:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R3749:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R3981:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R4091:Bckdk	UTSW	7	127905418	missense	probably damaging	1.00
R4303:Bckdk	UTSW	7	127905330	intron	probably benign
R4367:Bckdk	UTSW	7	127906419	missense	probably benign	0.07
R4369:Bckdk	UTSW	7	127906419	missense	probably benign	0.07
R4371:Bckdk	UTSW	7	127906419	missense	probably benign	0.07
R4841:Bckdk	UTSW	7	127905461	splice site	probably null
R5615:Bckdk	UTSW	7	127907317	missense	probably damaging	1.00
R5930:Bckdk	UTSW	7	127905973	missense	probably damaging	1.00
R7215:Bckdk	UTSW	7	127905110	missense	possibly damaging	0.82
R7490:Bckdk	UTSW	7	127904973	missense	unknown
R7596:Bckdk	UTSW	7	127906400	nonsense	probably null
R7772:Bckdk	UTSW	7	127905901	missense	probably damaging	1.00
R7973:Bckdk	UTSW	7	127906367	missense	probably benign	0.21
R8395:Bckdk	UTSW	7	127907967	missense	probably benign	0.08
R8396:Bckdk	UTSW	7	127905759	missense	probably damaging	1.00
R8930:Bckdk	UTSW	7	127908010	missense	probably benign	0.04
R8932:Bckdk	UTSW	7	127908010	missense	probably benign	0.04
R9102:Bckdk	UTSW	7	127907486	missense	probably null	0.94
R9361:Bckdk	UTSW	7	127907343	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TATCTGGTGCTCAAAGTGCGTC -3'
(R):5'- TGAGGCTTAGTCCCATCCAG -3'

Sequencing Primer
(F):5'- GTGCTCAAAGTGCGTCTTCCC -3'
(R):5'- GACCTGATACCTTTCAGCAGG -3'

Posted On

2015-04-17