Incidental Mutation 'R3750:Adam26b'
ID310146
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43521197 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 256 (V256G)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably benign
Transcript: ENSMUST00000080135
AA Change: V256G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: V256G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7596:Adam26b UTSW 8 43520200 missense probably benign
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7769:Adam26b UTSW 8 43521695 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7918:Adam26b UTSW 8 43521101 missense probably benign 0.14
R8286:Adam26b UTSW 8 43519961 missense probably benign 0.05
R8897:Adam26b UTSW 8 43520972 missense possibly damaging 0.91
R8922:Adam26b UTSW 8 43520179 missense probably damaging 1.00
R9075:Adam26b UTSW 8 43520368 missense probably benign 0.07
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTGTGCCATGTCTGACATTAC -3'
(R):5'- GGACCCACCACAGGTTTATTG -3'

Sequencing Primer
(F):5'- GTGTGCCATGTCTGACATTACATCAG -3'
(R):5'- CCACCACAGGTTTATTGAATATTTTG -3'
Posted On2015-04-17