Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:Adam26b'

310146

Institutional Source

Beutler Lab

Gene Symbol

Adam26b

Ensembl Gene

ENSMUSG00000063900

Gene Name

a disintegrin and metallopeptidase domain 26B

Synonyms

MMRRC Submission

040735-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43519762-43528106 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 43521197 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 256 (V256G)

Ref Sequence

ENSEMBL: ENSMUSP00000079032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080135]

AlphaFold

Q6IMH6

Predicted Effect

probably benign
Transcript: ENSMUST00000080135
AA Change: V256G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: V256G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	29	147	4.9e-18	PFAM
Pfam:Reprolysin_5	193	364	4.8e-15	PFAM
Pfam:Reprolysin_4	194	380	1.3e-8	PFAM
Pfam:Reprolysin	195	385	9.9e-50	PFAM
Pfam:Reprolysin_2	215	377	3.9e-15	PFAM
Pfam:Reprolysin_3	219	340	2e-15	PFAM
DISIN	401	476	5.88e-40	SMART
ACR	477	613	7.69e-64	SMART
low complexity region	631	642	N/A	INTRINSIC
transmembrane domain	670	692	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Adam26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Adam26b	APN	8	43520179	missense	probably damaging	1.00
IGL00806:Adam26b	APN	8	43521342	missense	probably damaging	1.00
IGL00984:Adam26b	APN	8	43520373	missense	possibly damaging	0.86
IGL01081:Adam26b	APN	8	43519938	missense	probably benign	0.00
IGL01783:Adam26b	APN	8	43521761	missense	probably benign	0.30
IGL02021:Adam26b	APN	8	43519872	missense	probably benign
IGL02707:Adam26b	APN	8	43519858	utr 3 prime	probably benign
IGL03112:Adam26b	APN	8	43521512	missense	probably benign
R0195:Adam26b	UTSW	8	43520270	missense	probably damaging	0.99
R0453:Adam26b	UTSW	8	43520350	missense	probably benign	0.00
R0562:Adam26b	UTSW	8	43520371	missense	probably benign	0.36
R0645:Adam26b	UTSW	8	43520487	missense	probably damaging	1.00
R0763:Adam26b	UTSW	8	43520564	missense	probably damaging	1.00
R1697:Adam26b	UTSW	8	43520963	missense	probably damaging	0.98
R1739:Adam26b	UTSW	8	43521677	missense	probably damaging	1.00
R1751:Adam26b	UTSW	8	43519911	missense	probably benign	0.00
R1767:Adam26b	UTSW	8	43519911	missense	probably benign	0.00
R1994:Adam26b	UTSW	8	43520639	missense	probably benign	0.44
R3747:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3748:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3771:Adam26b	UTSW	8	43520714	missense	probably damaging	1.00
R4027:Adam26b	UTSW	8	43520372	missense	probably benign	0.09
R4652:Adam26b	UTSW	8	43521338	missense	possibly damaging	0.49
R4790:Adam26b	UTSW	8	43520727	missense	probably benign	0.19
R4859:Adam26b	UTSW	8	43520259	missense	possibly damaging	0.80
R5059:Adam26b	UTSW	8	43520600	missense	probably damaging	1.00
R5191:Adam26b	UTSW	8	43519991	missense	probably damaging	1.00
R5540:Adam26b	UTSW	8	43521617	missense	probably damaging	1.00
R5568:Adam26b	UTSW	8	43520492	missense	probably benign	0.00
R5886:Adam26b	UTSW	8	43520273	missense	possibly damaging	0.72
R5935:Adam26b	UTSW	8	43521298	missense	probably benign	0.00
R5983:Adam26b	UTSW	8	43521341	missense	probably damaging	1.00
R6544:Adam26b	UTSW	8	43521781	missense	probably damaging	0.98
R6610:Adam26b	UTSW	8	43521153	missense	probably damaging	1.00
R6668:Adam26b	UTSW	8	43520690	missense	possibly damaging	0.72
R6966:Adam26b	UTSW	8	43521435	missense	possibly damaging	0.51
R7545:Adam26b	UTSW	8	43521713	missense	probably damaging	0.98
R7596:Adam26b	UTSW	8	43520200	missense	probably benign
R7634:Adam26b	UTSW	8	43520997	missense	probably benign
R7657:Adam26b	UTSW	8	43521542	missense	possibly damaging	0.95
R7692:Adam26b	UTSW	8	43520795	missense	probably benign	0.00
R7769:Adam26b	UTSW	8	43521695	missense	probably benign	0.00
R7912:Adam26b	UTSW	8	43520208	missense	probably benign	0.13
R7918:Adam26b	UTSW	8	43521101	missense	probably benign	0.14
R8286:Adam26b	UTSW	8	43519961	missense	probably benign	0.05
R8897:Adam26b	UTSW	8	43520972	missense	possibly damaging	0.91
R8922:Adam26b	UTSW	8	43520179	missense	probably damaging	1.00
R9075:Adam26b	UTSW	8	43520368	missense	probably benign	0.07
R9225:Adam26b	UTSW	8	43520416	nonsense	probably null
X0066:Adam26b	UTSW	8	43520004	missense	probably damaging	0.97
Z1088:Adam26b	UTSW	8	43520597	missense	probably damaging	0.99
Z1177:Adam26b	UTSW	8	43520698	missense	probably benign	0.24
Z1177:Adam26b	UTSW	8	43521422	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGTGTGCCATGTCTGACATTAC -3'
(R):5'- GGACCCACCACAGGTTTATTG -3'

Sequencing Primer
(F):5'- GTGTGCCATGTCTGACATTACATCAG -3'
(R):5'- CCACCACAGGTTTATTGAATATTTTG -3'

Posted On

2015-04-17