Incidental Mutation 'R3750:Cyp4v3'
ID310147
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Namecytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45304944-45333216 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 45315708 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 272 (R272*)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095328]
Predicted Effect probably null
Transcript: ENSMUST00000095328
AA Change: R272*
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: R272*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45307003 missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45307021 missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45320615 missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45308374 splice site probably null
IGL02565:Cyp4v3 APN 8 45320637 missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45308716 missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45308651 unclassified probably benign
R1818:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45306952 missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45317776 missense probably benign
R3747:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3748:Cyp4v3 UTSW 8 45315708 nonsense probably null
R4289:Cyp4v3 UTSW 8 45328223 missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45306992 missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45320637 missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45306980 missense probably damaging 1.00
R5479:Cyp4v3 UTSW 8 45310206 missense probably benign 0.00
R5667:Cyp4v3 UTSW 8 45308535 missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45321784 missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45320160 missense probably damaging 1.00
R6470:Cyp4v3 UTSW 8 45317736 nonsense probably null
R6592:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R6700:Cyp4v3 UTSW 8 45307093 missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45310252 missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45321750 missense probably benign 0.01
R7966:Cyp4v3 UTSW 8 45332917 missense probably benign 0.44
R8331:Cyp4v3 UTSW 8 45315708 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATGAAGGTGTCAACTTCCTC -3'
(R):5'- AAAACTCTGCGTTTGTCCTGTC -3'

Sequencing Primer
(F):5'- AAGGTGTCAACTTCCTCTCGGATG -3'
(R):5'- CTGAGAAAGTATCAGGTGGG -3'
Posted On2015-04-17