Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:Zswim4'

310150

Institutional Source

Beutler Lab

Gene Symbol

Zswim4

Ensembl Gene

ENSMUSG00000035671

Gene Name

zinc finger SWIM-type containing 4

Synonyms

E130119J17Rik

MMRRC Submission

040735-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84210678-84237055 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84212047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1069 (P1069S)

Ref Sequence

ENSEMBL: ENSMUSP00000040078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039480]

AlphaFold

Q8C7B8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039480
AA Change: P1069S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671
AA Change: P1069S

Domain	Start	End	E-Value	Type
low complexity region	531	545	N/A	INTRINSIC
low complexity region	576	588	N/A	INTRINSIC
low complexity region	607	628	N/A	INTRINSIC
low complexity region	672	683	N/A	INTRINSIC
low complexity region	907	917	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083607

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199621

Meta Mutation Damage Score

0.0876

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het

Other mutations in Zswim4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Zswim4	APN	8	84212140	missense	probably damaging	1.00
IGL03048:Zswim4	UTSW	8	84211975	missense	possibly damaging	0.95
R0217:Zswim4	UTSW	8	84212664	missense	probably damaging	1.00
R0688:Zswim4	UTSW	8	84228888	missense	possibly damaging	0.93
R1217:Zswim4	UTSW	8	84219972	missense	possibly damaging	0.89
R1853:Zswim4	UTSW	8	84224200	missense	probably damaging	1.00
R1878:Zswim4	UTSW	8	84212776	missense	possibly damaging	0.55
R2205:Zswim4	UTSW	8	84225869	missense	possibly damaging	0.70
R2940:Zswim4	UTSW	8	84223748	missense	probably damaging	1.00
R3747:Zswim4	UTSW	8	84212047	missense	possibly damaging	0.86
R3748:Zswim4	UTSW	8	84212047	missense	possibly damaging	0.86
R4777:Zswim4	UTSW	8	84236957	missense	probably benign
R4831:Zswim4	UTSW	8	84212319	missense	probably damaging	1.00
R4959:Zswim4	UTSW	8	84212223	missense	probably benign	0.22
R4968:Zswim4	UTSW	8	84217372	missense	probably benign	0.37
R4973:Zswim4	UTSW	8	84212223	missense	probably benign	0.22
R4977:Zswim4	UTSW	8	84226667	splice site	probably null
R4978:Zswim4	UTSW	8	84226667	splice site	probably null
R4980:Zswim4	UTSW	8	84226667	splice site	probably null
R4981:Zswim4	UTSW	8	84226667	splice site	probably null
R4982:Zswim4	UTSW	8	84226667	splice site	probably null
R4983:Zswim4	UTSW	8	84226667	splice site	probably null
R5248:Zswim4	UTSW	8	84219932	missense	probably benign	0.13
R5337:Zswim4	UTSW	8	84235079	missense	probably damaging	1.00
R5366:Zswim4	UTSW	8	84212790	missense	probably benign	0.39
R5646:Zswim4	UTSW	8	84231110	splice site	probably null
R5845:Zswim4	UTSW	8	84217242	splice site	probably null
R6193:Zswim4	UTSW	8	84226145	missense	probably benign
R6270:Zswim4	UTSW	8	84230951	missense	probably damaging	1.00
R6648:Zswim4	UTSW	8	84230914	missense	probably benign	0.22
R6920:Zswim4	UTSW	8	84214085	missense	probably benign	0.01
R7117:Zswim4	UTSW	8	84214052	missense	probably damaging	1.00
R7155:Zswim4	UTSW	8	84219927	missense	probably damaging	1.00
R7344:Zswim4	UTSW	8	84223698	nonsense	probably null
R7354:Zswim4	UTSW	8	84228849	missense	probably damaging	1.00
R8036:Zswim4	UTSW	8	84223289	missense	probably benign	0.22
R8408:Zswim4	UTSW	8	84212385	missense	possibly damaging	0.82
R8518:Zswim4	UTSW	8	84211957	missense	probably damaging	1.00
R8750:Zswim4	UTSW	8	84212684	missense	possibly damaging	0.82
R8830:Zswim4	UTSW	8	84223316	missense	possibly damaging	0.92
R8838:Zswim4	UTSW	8	84214070	missense	probably damaging	1.00
R8840:Zswim4	UTSW	8	84214070	missense	probably damaging	1.00
R8842:Zswim4	UTSW	8	84214070	missense	probably damaging	1.00
R9185:Zswim4	UTSW	8	84237004	start codon destroyed	probably null	0.94
R9355:Zswim4	UTSW	8	84229058	missense	probably damaging	1.00
R9432:Zswim4	UTSW	8	84236910	missense	probably damaging	1.00
R9635:Zswim4	UTSW	8	84212725	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTTGTCTGCACACTCCTAGGC -3'
(R):5'- GCTACCAAACCACTAGGGACTG -3'

Sequencing Primer
(F):5'- ACTTTACTGCAAGTAGCCATGGG -3'
(R):5'- CACTAGGGACTGACAGGGCAC -3'

Posted On

2015-04-17