Incidental Mutation 'R3750:Marcks'
ID310153
Institutional Source Beutler Lab
Gene Symbol Marcks
Ensembl Gene ENSMUSG00000069662
Gene Namemyristoylated alanine rich protein kinase C substrate
SynonymsMacs
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location37133375-37138920 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 37140870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092584]
PDB Structure
Crystal Structure of MARCKS calmodulin binding domain peptide complexed with Ca2+/Calmodulin [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062667
SMART Domains Protein: ENSMUSP00000058515
Gene: ENSMUSG00000046463

DomainStartEndE-ValueType
low complexity region 47 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092584
SMART Domains Protein: ENSMUSP00000090245
Gene: ENSMUSG00000069662

DomainStartEndE-ValueType
Pfam:MARCKS 2 309 6e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217338
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit perinatal lethality, absence of the corpus callosum and other forebrain commisures, neuronal ectopia, and defects of cortical and retinal lamination. About one-fourth of fetuses are exencephalic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Marcks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Marcks APN 10 37138517 missense probably damaging 1.00
R0675:Marcks UTSW 10 37141185 unclassified probably benign
R5385:Marcks UTSW 10 37138457 missense probably damaging 1.00
R5608:Marcks UTSW 10 37136916 missense probably damaging 0.99
R5838:Marcks UTSW 10 37136167 missense probably benign 0.39
R7522:Marcks UTSW 10 37136581 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAAAGTCAACTGGGCTGGTCC -3'
(R):5'- TCAGCTGCAAAGTAGGGACC -3'

Sequencing Primer
(F):5'- TCAACTGGGCTGGTCCAACAC -3'
(R):5'- ACAGCCCGCGTGTTTAC -3'
Posted On2015-04-17