Incidental Mutation 'R3750:Hsd17b3'
ID310155
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Namehydroxysteroid (17-beta) dehydrogenase 3
Synonyms17(beta)HSD type 3
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64058266-64089230 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 64063179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222783] [ENSMUST00000222810]
Predicted Effect probably null
Transcript: ENSMUST00000039832
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039832
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166224
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166224
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221513
Predicted Effect probably null
Transcript: ENSMUST00000222783
Predicted Effect probably null
Transcript: ENSMUST00000222783
Predicted Effect probably benign
Transcript: ENSMUST00000222810
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0684:Hsd17b3 UTSW 13 64089068 missense probably benign
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5897:Hsd17b3 UTSW 13 64088985 critical splice donor site probably null
R5992:Hsd17b3 UTSW 13 64059470 unclassified probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CACAAAAGCCTGCAGTGAG -3'
(R):5'- TTACGCCGCAAGACTACAG -3'

Sequencing Primer
(F):5'- TTATAGACAGCTCCCTCGGG -3'
(R):5'- GCCGCAAGACTACAGAGTGAC -3'
Posted On2015-04-17