Incidental Mutation 'R3750:Spata31'
ID310156
Institutional Source Beutler Lab
Gene Symbol Spata31
Ensembl Gene ENSMUSG00000056223
Gene Namespermatogenesis associated 31
Synonyms4930458L03Rik, Fam75a, Spata31a
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64917406-64923194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64921743 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 568 (L568F)
Ref Sequence ENSEMBL: ENSMUSP00000097025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070216] [ENSMUST00000221202]
Predicted Effect probably benign
Transcript: ENSMUST00000070216
AA Change: L568F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097025
Gene: ENSMUSG00000056223
AA Change: L568F

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:FAM75 149 431 1.7e-83 PFAM
Pfam:FAM75 426 462 4.5e-9 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221202
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Spata31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Spata31 APN 13 64922788 nonsense probably null
IGL01143:Spata31 APN 13 64920816 nonsense probably null
IGL01321:Spata31 APN 13 64921754 missense probably benign 0.01
IGL01624:Spata31 APN 13 64921585 missense probably damaging 1.00
IGL01844:Spata31 APN 13 64921154 missense possibly damaging 0.49
IGL02259:Spata31 APN 13 64921483 missense possibly damaging 0.90
IGL02358:Spata31 APN 13 64921218 missense probably benign
IGL02377:Spata31 APN 13 64920380 missense probably damaging 0.98
IGL02723:Spata31 APN 13 64920649 missense probably benign 0.10
IGL03125:Spata31 APN 13 64920889 missense probably benign 0.09
IGL03343:Spata31 APN 13 64919773 missense probably benign 0.41
BB006:Spata31 UTSW 13 64921718 missense probably benign 0.04
BB016:Spata31 UTSW 13 64921718 missense probably benign 0.04
F5770:Spata31 UTSW 13 64921648 missense probably benign 0.18
IGL02991:Spata31 UTSW 13 64920719 missense probably benign 0.05
P0043:Spata31 UTSW 13 64921006 splice site probably null
PIT4366001:Spata31 UTSW 13 64921505 nonsense probably null
PIT4458001:Spata31 UTSW 13 64921850 missense probably benign 0.01
PIT4687001:Spata31 UTSW 13 64921337 missense probably benign 0.02
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0639:Spata31 UTSW 13 64922213 missense probably benign 0.02
R1253:Spata31 UTSW 13 64922024 missense probably benign 0.23
R1536:Spata31 UTSW 13 64921382 missense probably damaging 1.00
R1656:Spata31 UTSW 13 64921139 missense probably benign
R1802:Spata31 UTSW 13 64922383 missense probably benign 0.01
R1813:Spata31 UTSW 13 64921798 missense probably benign 0.32
R1916:Spata31 UTSW 13 64922545 nonsense probably null
R1917:Spata31 UTSW 13 64920865 missense possibly damaging 0.92
R1933:Spata31 UTSW 13 64920610 missense probably benign 0.02
R2910:Spata31 UTSW 13 64920436 missense probably benign 0.12
R3876:Spata31 UTSW 13 64920931 missense probably benign 0.03
R3980:Spata31 UTSW 13 64922654 missense probably benign 0.24
R4056:Spata31 UTSW 13 64921655 missense probably benign 0.00
R4300:Spata31 UTSW 13 64919761 missense probably benign 0.08
R4797:Spata31 UTSW 13 64922742 nonsense probably null
R4997:Spata31 UTSW 13 64919723 missense probably benign 0.00
R5185:Spata31 UTSW 13 64917526 missense possibly damaging 0.93
R5366:Spata31 UTSW 13 64920459 missense probably damaging 0.98
R5539:Spata31 UTSW 13 64922969 missense probably benign 0.00
R5704:Spata31 UTSW 13 64922041 missense probably benign 0.32
R5748:Spata31 UTSW 13 64920313 makesense probably null
R5834:Spata31 UTSW 13 64922666 missense probably benign 0.19
R5926:Spata31 UTSW 13 64920725 missense possibly damaging 0.82
R6476:Spata31 UTSW 13 64917642 missense possibly damaging 0.68
R6603:Spata31 UTSW 13 64922665 missense probably damaging 1.00
R6620:Spata31 UTSW 13 64919757 missense possibly damaging 0.68
R6965:Spata31 UTSW 13 64922834 missense possibly damaging 0.90
R7086:Spata31 UTSW 13 64922229 missense probably benign 0.02
R7140:Spata31 UTSW 13 64921099 missense probably benign
R7396:Spata31 UTSW 13 64920733 missense probably benign
R7545:Spata31 UTSW 13 64922545 nonsense probably null
R7575:Spata31 UTSW 13 64922912 missense unknown
R7607:Spata31 UTSW 13 64921592 missense probably damaging 1.00
R7929:Spata31 UTSW 13 64921718 missense probably benign 0.04
R8024:Spata31 UTSW 13 64922804 missense probably benign 0.12
R8088:Spata31 UTSW 13 64920865 missense probably benign 0.31
R8323:Spata31 UTSW 13 64922251 missense possibly damaging 0.61
R8362:Spata31 UTSW 13 64922230 missense possibly damaging 0.58
V7580:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7581:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7583:Spata31 UTSW 13 64921648 missense probably benign 0.18
Z1176:Spata31 UTSW 13 64921972 nonsense probably null
Z1177:Spata31 UTSW 13 64921972 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCACAGGTGGAGTCTACC -3'
(R):5'- GCAGTAAAACGACTTCTCGAG -3'

Sequencing Primer
(F):5'- GGTGGAGTCTACCCCTTAAGATAC -3'
(R):5'- CTTGAAGATAGTCCTAGTCTGAGAG -3'
Posted On2015-04-17