Incidental Mutation 'R3750:Foxd1'
ID310157
Institutional Source Beutler Lab
Gene Symbol Foxd1
Ensembl Gene ENSMUSG00000078302
Gene Nameforkhead box D1
SynonymsHfh10, BF-2, FREAC4, Hfhbf2
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location98354242-98359305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 98355916 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 433 (A433P)
Ref Sequence ENSEMBL: ENSMUSP00000100725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105098]
Predicted Effect unknown
Transcript: ENSMUST00000105098
AA Change: A433P
SMART Domains Protein: ENSMUSP00000100725
Gene: ENSMUSG00000078302
AA Change: A433P

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 83 124 N/A INTRINSIC
FH 128 218 7.63e-61 SMART
low complexity region 231 280 N/A INTRINSIC
low complexity region 282 323 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 378 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. Studies of the orthologous mouse protein indicate that it functions in kidney development by promoting nephron progenitor differentiation, and it also functions in the development of the retina and optic chiasm. It may also regulate inflammatory reactions and prevent autoimmunity. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for this targeted mutation die within 24 hours after birth with severe defects in nephrogenesis, and abnormal development of the renal collecting system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Foxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1674:Foxd1 UTSW 13 98354839 missense unknown
R2328:Foxd1 UTSW 13 98355152 missense probably damaging 1.00
R3747:Foxd1 UTSW 13 98355916 missense unknown
R5524:Foxd1 UTSW 13 98355904 missense unknown
R5846:Foxd1 UTSW 13 98355041 missense probably damaging 1.00
R6880:Foxd1 UTSW 13 98354717 missense unknown
Z1176:Foxd1 UTSW 13 98355938 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCCATCGAGAGCCTCATC -3'
(R):5'- TGGTCCAAGAATCCGAAGCG -3'

Sequencing Primer
(F):5'- CCTCATCGGGCGCACTC -3'
(R):5'- CCGAAGCGGCGAAAATG -3'
Posted On2015-04-17