Incidental Mutation 'R3750:Mroh2b'
ID310159
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 4952246 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 1513 (W1513*)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably null
Transcript: ENSMUST00000045736
AA Change: W1513*
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W1513*

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCATGACAACTTTCAGTC -3'
(R):5'- AGGTAACACATTTCTTCCCACTG -3'

Sequencing Primer
(F):5'- CAGTCAATTAATGTATGGCGATGG -3'
(R):5'- ACTGCCCCCGATGTCCATC -3'
Posted On2015-04-17