Mutagenetix > Incidental Mutation

Incidental Mutation 'R3750:Pdzph1'

310161

Institutional Source

Beutler Lab

Gene Symbol

Pdzph1

Ensembl Gene

ENSMUSG00000024227

Gene Name

PDZ and pleckstrin homology domains 1

Synonyms

2610034M16Rik

MMRRC Submission

040735-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58878808-58991375 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 58973336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 650 (Y650*)

Ref Sequence

ENSEMBL: ENSMUSP00000025064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025064]

AlphaFold

Q8BGR1

Predicted Effect

probably null
Transcript: ENSMUST00000025064
AA Change: Y650*

SMART Domains

Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: Y650*

Domain	Start	End	E-Value	Type
Blast:PDZ	780	844	6e-20	BLAST
PDZ	915	984	3.31e-15	SMART
PH	993	1096	9.4e-19	SMART
PH	1120	1218	2.83e-13	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Plce1	A	C	19: 38,777,899	I2109L	probably benign	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Pdzph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Pdzph1	APN	17	58974796	missense	possibly damaging	0.46
IGL00644:Pdzph1	APN	17	58888110	missense	probably benign
IGL01413:Pdzph1	APN	17	58879152	missense	possibly damaging	0.82
IGL01530:Pdzph1	APN	17	58922715	missense	probably damaging	1.00
IGL02089:Pdzph1	APN	17	58967339	missense	possibly damaging	0.92
IGL02201:Pdzph1	APN	17	58967511	splice site	probably benign
IGL02548:Pdzph1	APN	17	58973391	missense	probably benign	0.10
IGL02618:Pdzph1	APN	17	58879073	utr 3 prime	probably benign
IGL02660:Pdzph1	APN	17	58880647	missense	probably damaging	0.97
IGL02749:Pdzph1	APN	17	58932483	missense	possibly damaging	0.95
IGL02876:Pdzph1	APN	17	58974069	missense	probably benign
IGL03304:Pdzph1	APN	17	58880646	missense	probably damaging	1.00
IGL03336:Pdzph1	APN	17	58974234	missense	probably benign	0.00
R0008:Pdzph1	UTSW	17	58922761	splice site	probably benign
R0008:Pdzph1	UTSW	17	58922761	splice site	probably benign
R0498:Pdzph1	UTSW	17	58973830	missense	probably benign	0.00
R0553:Pdzph1	UTSW	17	58922727	missense	probably damaging	1.00
R0594:Pdzph1	UTSW	17	58954479	missense	possibly damaging	0.76
R1306:Pdzph1	UTSW	17	58932432	missense	possibly damaging	0.90
R1370:Pdzph1	UTSW	17	58974087	missense	possibly damaging	0.73
R1382:Pdzph1	UTSW	17	58974747	missense	probably benign	0.10
R1463:Pdzph1	UTSW	17	58932445	missense	probably damaging	1.00
R1766:Pdzph1	UTSW	17	58973752	missense	probably benign	0.16
R1773:Pdzph1	UTSW	17	58974813	missense	probably damaging	0.98
R1862:Pdzph1	UTSW	17	58922583	missense	probably damaging	1.00
R2070:Pdzph1	UTSW	17	58974097	missense	probably benign	0.04
R2071:Pdzph1	UTSW	17	58974097	missense	probably benign	0.04
R2229:Pdzph1	UTSW	17	58932412	splice site	probably benign
R2264:Pdzph1	UTSW	17	58888167	critical splice acceptor site	probably null
R2334:Pdzph1	UTSW	17	58922649	missense	probably damaging	1.00
R4700:Pdzph1	UTSW	17	58974546	missense	probably damaging	0.98
R4847:Pdzph1	UTSW	17	58973530	missense	possibly damaging	0.95
R4868:Pdzph1	UTSW	17	58974756	missense	probably benign	0.00
R5130:Pdzph1	UTSW	17	58922609	missense	probably damaging	1.00
R5329:Pdzph1	UTSW	17	58974880	missense	probably damaging	1.00
R5574:Pdzph1	UTSW	17	58973947	missense	probably benign	0.00
R5770:Pdzph1	UTSW	17	58879151	missense	probably damaging	1.00
R5795:Pdzph1	UTSW	17	58885867	missense	possibly damaging	0.47
R5842:Pdzph1	UTSW	17	58974412	missense	possibly damaging	0.64
R5851:Pdzph1	UTSW	17	58973746	missense	probably benign	0.02
R6158:Pdzph1	UTSW	17	58973627	missense	probably damaging	0.96
R6813:Pdzph1	UTSW	17	58974436	missense	probably benign	0.08
R7022:Pdzph1	UTSW	17	58974126	missense	probably benign	0.02
R7395:Pdzph1	UTSW	17	58879159	missense	possibly damaging	0.85
R7525:Pdzph1	UTSW	17	58967341	missense	possibly damaging	0.73
R7944:Pdzph1	UTSW	17	58932460	missense	probably damaging	1.00
R7945:Pdzph1	UTSW	17	58932460	missense	probably damaging	1.00
R7992:Pdzph1	UTSW	17	58879110	missense	possibly damaging	0.71
R8016:Pdzph1	UTSW	17	58932481	missense	probably damaging	0.98
R8116:Pdzph1	UTSW	17	58975143	missense	probably benign	0.01
R8273:Pdzph1	UTSW	17	58973014	missense	probably benign	0.00
R8523:Pdzph1	UTSW	17	58884013	missense	probably damaging	1.00
R8819:Pdzph1	UTSW	17	58880720	nonsense	probably null
R8820:Pdzph1	UTSW	17	58880720	nonsense	probably null
R8839:Pdzph1	UTSW	17	58950242	missense	probably benign	0.02
R8871:Pdzph1	UTSW	17	58888038	missense	probably damaging	1.00
R8898:Pdzph1	UTSW	17	58974339	missense	probably benign	0.00
R8959:Pdzph1	UTSW	17	58974604	missense	probably damaging	0.97
R9043:Pdzph1	UTSW	17	58973540	missense	probably benign	0.05
R9083:Pdzph1	UTSW	17	58954400	missense	possibly damaging	0.94
R9092:Pdzph1	UTSW	17	58973130	missense	probably damaging	1.00
R9682:Pdzph1	UTSW	17	58950267	missense	probably damaging	1.00
R9757:Pdzph1	UTSW	17	58974903	nonsense	probably null
R9774:Pdzph1	UTSW	17	58974756	missense	probably benign	0.00
X0028:Pdzph1	UTSW	17	58879121	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTGAATCGTCATCACTGGC -3'
(R):5'- GCTCTGTGGAATGGAATCAAAC -3'

Sequencing Primer
(F):5'- GGTGGACTCAGAGGAATT -3'
(R):5'- TGGAATCAAACAGAGGACCATGC -3'

Posted On

2015-04-17