Mutagenetix > Incidental Mutations

Incidental Mutation 'R3750:Plce1'

310162

Institutional Source

Beutler Lab

Gene Symbol

Plce1

Ensembl Gene

ENSMUSG00000024998

Gene Name

phospholipase C, epsilon 1

Synonyms

4933403A21Rik, PLCepsilon

MMRRC Submission

040735-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.431) question?

Stock #

R3750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38481109-38785030 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 38777899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 2109 (I2109L)

Ref Sequence

ENSEMBL: ENSMUSP00000138360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]

AlphaFold

Q8K4S1

Predicted Effect

probably benign
Transcript: ENSMUST00000169713
AA Change: I2109L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: I2109L

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	7.6e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182267
AA Change: I2123L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: I2123L

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	5.9e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1552	1581	N/A	INTRINSIC
SCOP:d1qasa3	1648	1676	1e-3	SMART
low complexity region	1680	1694	N/A	INTRINSIC
PLCYc	1724	1840	4.28e-46	SMART
C2	1864	1962	3.7e-10	SMART
PDB:2BYE\|A	2000	2108	6e-47	PDB
RA	2129	2232	1.12e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182481
AA Change: I2109L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: I2109L

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	8e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182589

Meta Mutation Damage Score

0.0708

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,753,577	T1178I	probably damaging	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Adam12	T	C	7: 134,172,865	D5G	probably damaging	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bub1b	T	A	2: 118,615,455	N319K	possibly damaging	Het
Clcn6	G	T	4: 148,024,187	C128*	probably null	Het
Col6a4	C	A	9: 106,020,665		probably null	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Dlg5	G	A	14: 24,165,260	A665V	probably damaging	Het
Foxd1	G	C	13: 98,355,916	A433P	unknown	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Hsd17b3	A	T	13: 64,063,179		probably null	Het
Kcnc4	A	G	3: 107,448,190	V314A	probably benign	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Marcks	G	A	10: 37,140,870		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nefh	A	G	11: 4,939,937	V894A	probably benign	Het
Pdzph1	A	T	17: 58,973,336	Y650*	probably null	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Rtca	A	T	3: 116,493,001	F327L	probably benign	Het
Scn2a	T	G	2: 65,713,771	V832G	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skil	A	G	3: 31,116,834	N354S	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Spata31	G	T	13: 64,921,743	L568F	probably benign	Het
Spon1	T	C	7: 113,766,384	L19P	probably damaging	Het
Spon1	T	A	7: 114,016,791	V297E	possibly damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tcp11l1	A	G	2: 104,698,542	I137T	probably damaging	Het
Ttn	G	A	2: 76,754,006	H22253Y	probably damaging	Het
Upf1	G	T	8: 70,333,350	N975K	possibly damaging	Het
Usp1	C	T	4: 98,934,120		probably null	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Plce1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Plce1	APN	19	38745788	missense	probably damaging	0.99
IGL00336:Plce1	APN	19	38651906	missense	probably damaging	1.00
IGL00430:Plce1	APN	19	38725017	missense	probably damaging	1.00
IGL00466:Plce1	APN	19	38721029	missense	probably damaging	0.99
IGL00477:Plce1	APN	19	38525132	missense	probably benign	0.39
IGL00839:Plce1	APN	19	38698562	missense	probably damaging	1.00
IGL01292:Plce1	APN	19	38651785	splice site	probably benign
IGL01665:Plce1	APN	19	38524887	missense	probably benign	0.01
IGL01826:Plce1	APN	19	38739238	splice site	probably benign
IGL01833:Plce1	APN	19	38720981	missense	probably damaging	1.00
IGL02201:Plce1	APN	19	38769446	splice site	probably benign
IGL02276:Plce1	APN	19	38524757	missense	probably benign	0.05
IGL02477:Plce1	APN	19	38719553	splice site	probably benign
IGL02746:Plce1	APN	19	38698472	missense	probably damaging	1.00
Angel_food	UTSW	19	38727013	splice site	probably benign
Heavenly	UTSW	19	38777989	missense	probably damaging	1.00
R0058:Plce1	UTSW	19	38525184	missense	possibly damaging	0.90
R0058:Plce1	UTSW	19	38525184	missense	possibly damaging	0.90
R0064:Plce1	UTSW	19	38780784	critical splice donor site	probably null
R0116:Plce1	UTSW	19	38721821	missense	probably benign
R0138:Plce1	UTSW	19	38524419	missense	possibly damaging	0.49
R0240:Plce1	UTSW	19	38728886	missense	probably damaging	0.99
R0240:Plce1	UTSW	19	38728886	missense	probably damaging	0.99
R0504:Plce1	UTSW	19	38778021	splice site	probably benign
R0506:Plce1	UTSW	19	38760138	missense	probably benign	0.04
R0578:Plce1	UTSW	19	38777939	missense	probably damaging	1.00
R0645:Plce1	UTSW	19	38777989	missense	probably damaging	1.00
R0730:Plce1	UTSW	19	38716691	missense	probably damaging	0.98
R0920:Plce1	UTSW	19	38736521	missense	probably damaging	1.00
R1223:Plce1	UTSW	19	38702013	missense	probably damaging	1.00
R1223:Plce1	UTSW	19	38767226	missense	probably damaging	1.00
R1484:Plce1	UTSW	19	38705339	nonsense	probably null
R1488:Plce1	UTSW	19	38716803	missense	possibly damaging	0.92
R1598:Plce1	UTSW	19	38720996	missense	probably damaging	1.00
R1624:Plce1	UTSW	19	38724775	missense	probably damaging	1.00
R1732:Plce1	UTSW	19	38716838	missense	possibly damaging	0.56
R1778:Plce1	UTSW	19	38780790	splice site	probably benign
R1797:Plce1	UTSW	19	38758948	critical splice donor site	probably null
R1872:Plce1	UTSW	19	38760077	missense	probably damaging	1.00
R1876:Plce1	UTSW	19	38780623	missense	probably damaging	1.00
R1991:Plce1	UTSW	19	38777924	missense	probably damaging	1.00
R2080:Plce1	UTSW	19	38727013	splice site	probably benign
R2103:Plce1	UTSW	19	38777924	missense	probably damaging	1.00
R2376:Plce1	UTSW	19	38777986	missense	probably benign	0.02
R2471:Plce1	UTSW	19	38779926	missense	probably damaging	1.00
R2511:Plce1	UTSW	19	38760054	missense	probably damaging	1.00
R2842:Plce1	UTSW	19	38524283	missense	probably damaging	1.00
R3037:Plce1	UTSW	19	38777884	missense	probably damaging	0.98
R3104:Plce1	UTSW	19	38620519	missense	probably benign	0.00
R3700:Plce1	UTSW	19	38705337	missense	probably damaging	1.00
R3753:Plce1	UTSW	19	38651834	missense	probably benign	0.09
R4027:Plce1	UTSW	19	38524265	missense	probably damaging	1.00
R4057:Plce1	UTSW	19	38760119	missense	probably damaging	1.00
R4376:Plce1	UTSW	19	38705447	critical splice donor site	probably null
R4433:Plce1	UTSW	19	38767301	missense	probably damaging	1.00
R4520:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4521:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4522:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4524:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4650:Plce1	UTSW	19	38524644	missense	probably benign	0.30
R4673:Plce1	UTSW	19	38749396	missense	possibly damaging	0.51
R4701:Plce1	UTSW	19	38725007	missense	probably benign	0.33
R4828:Plce1	UTSW	19	38769499	missense	probably damaging	1.00
R5103:Plce1	UTSW	19	38767215	missense	probably damaging	1.00
R5112:Plce1	UTSW	19	38651833	missense	probably benign	0.00
R5236:Plce1	UTSW	19	38770347	missense	probably benign	0.11
R5268:Plce1	UTSW	19	38758835	missense	possibly damaging	0.71
R5288:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5384:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5386:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5448:Plce1	UTSW	19	38779917	missense	probably damaging	1.00
R5452:Plce1	UTSW	19	38620482	missense	probably benign	0.01
R6004:Plce1	UTSW	19	38721871	missense	probably damaging	1.00
R6062:Plce1	UTSW	19	38524751	missense	probably benign
R6147:Plce1	UTSW	19	38702037	missense	probably damaging	1.00
R6247:Plce1	UTSW	19	38745845	missense	probably damaging	1.00
R6278:Plce1	UTSW	19	38725051	splice site	probably null
R6306:Plce1	UTSW	19	38769465	missense	probably damaging	1.00
R6317:Plce1	UTSW	19	38524530	nonsense	probably null
R6437:Plce1	UTSW	19	38525132	missense	probably benign	0.39
R6522:Plce1	UTSW	19	38748521	splice site	probably null
R7034:Plce1	UTSW	19	38739357	missense	probably damaging	1.00
R7036:Plce1	UTSW	19	38739357	missense	probably damaging	1.00
R7037:Plce1	UTSW	19	38702017	missense	probably damaging	1.00
R7069:Plce1	UTSW	19	38758940	missense	probably damaging	1.00
R7180:Plce1	UTSW	19	38779785	missense	probably damaging	1.00
R7189:Plce1	UTSW	19	38760137	missense	probably damaging	0.97
R7227:Plce1	UTSW	19	38726902	missense	probably benign	0.00
R7253:Plce1	UTSW	19	38698508	missense	probably damaging	1.00
R7278:Plce1	UTSW	19	38779896	missense	possibly damaging	0.58
R7287:Plce1	UTSW	19	38701903	missense	probably benign	0.02
R7422:Plce1	UTSW	19	38651885	missense	probably damaging	1.00
R7557:Plce1	UTSW	19	38765404	missense	probably benign	0.30
R7607:Plce1	UTSW	19	38524752	missense	probably benign
R7615:Plce1	UTSW	19	38524665	missense	probably benign	0.18
R7653:Plce1	UTSW	19	38749319	missense	probably benign	0.20
R7685:Plce1	UTSW	19	38748433	missense	probably benign	0.00
R7716:Plce1	UTSW	19	38716851	missense	probably benign
R7744:Plce1	UTSW	19	38620455	missense	possibly damaging	0.93
R7790:Plce1	UTSW	19	38780696	missense	probably damaging	0.97
R7921:Plce1	UTSW	19	38620553	missense	probably benign	0.03
R8070:Plce1	UTSW	19	38701839	missense	probably damaging	0.99
R8087:Plce1	UTSW	19	38736521	missense	probably damaging	1.00
R8116:Plce1	UTSW	19	38524818	missense	probably benign	0.32
R8178:Plce1	UTSW	19	38772979	missense	possibly damaging	0.93
R8321:Plce1	UTSW	19	38651936	missense	probably benign	0.00
R8416:Plce1	UTSW	19	38772997	missense	possibly damaging	0.77
R8544:Plce1	UTSW	19	38524459	missense	probably benign	0.00
R8713:Plce1	UTSW	19	38524901	missense	probably benign	0.01
R8850:Plce1	UTSW	19	38524367	missense	probably benign
R9217:Plce1	UTSW	19	38760107	missense	probably damaging	1.00
R9231:Plce1	UTSW	19	38716596	missense	probably benign	0.13
R9232:Plce1	UTSW	19	38716979	missense	probably benign	0.16
R9332:Plce1	UTSW	19	38737933	missense	probably damaging	1.00
RF018:Plce1	UTSW	19	38717207	missense	probably damaging	0.99
X0022:Plce1	UTSW	19	38726999	missense	probably damaging	1.00
X0065:Plce1	UTSW	19	38777914	missense	possibly damaging	0.48
Z1176:Plce1	UTSW	19	38701894	missense	probably damaging	1.00
Z1176:Plce1	UTSW	19	38724980	nonsense	probably null
Z1176:Plce1	UTSW	19	38769460	missense	probably damaging	1.00
Z1177:Plce1	UTSW	19	38651842	missense	probably null	0.48

Predicted Primers

PCR Primer
(F):5'- CAGGTTTATCTTTTCAGCAGGG -3'
(R):5'- AGGGGAGATTCTCATGGTGC -3'

Sequencing Primer
(F):5'- CAGGGTGCATGCAAAAGATC -3'
(R):5'- ATTCTCATGGTGCTGGGAGCC -3'

Posted On

2015-04-17