Incidental Mutation 'R3750:Slk'
ID310163
Institutional Source Beutler Lab
Gene Symbol Slk
Ensembl Gene ENSMUSG00000025060
Gene NameSTE20-like kinase
Synonyms9A2, Stk2, mSLK, Etk4, SLK
MMRRC Submission 040735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3750 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47579678-47645246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 47619809 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 400 (D400E)
Ref Sequence ENSEMBL: ENSMUSP00000026043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026043] [ENSMUST00000051691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026043
AA Change: D400E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026043
Gene: ENSMUSG00000025060
AA Change: D400E

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 849 928 1.2e-19 PFAM
Pfam:PKK 986 1127 7.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051691
AA Change: D400E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000049977
Gene: ENSMUSG00000025060
AA Change: D400E

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 850 988 1.6e-40 PFAM
Pfam:PKK 1018 1158 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136557
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die by E14.5, exhibiting severe developmental defects, impaired neuronal and skeletal muscle development, abnormal placental differentiation and vascularization, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,753,577 T1178I probably damaging Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Clcn6 G T 4: 148,024,187 C128* probably null Het
Col6a4 C A 9: 106,020,665 probably null Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dlg5 G A 14: 24,165,260 A665V probably damaging Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hsd17b3 A T 13: 64,063,179 probably null Het
Kcnc4 A G 3: 107,448,190 V314A probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Marcks G A 10: 37,140,870 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nefh A G 11: 4,939,937 V894A probably benign Het
Pdzph1 A T 17: 58,973,336 Y650* probably null Het
Plce1 A C 19: 38,777,899 I2109L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rtca A T 3: 116,493,001 F327L probably benign Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skil A G 3: 31,116,834 N354S probably benign Het
Spata31 G T 13: 64,921,743 L568F probably benign Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tcp11l1 A G 2: 104,698,542 I137T probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Usp1 C T 4: 98,934,120 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Slk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Slk APN 19 47619709 missense probably benign 0.00
IGL00515:Slk APN 19 47642096 unclassified probably benign
IGL00755:Slk APN 19 47609010 missense probably damaging 0.99
IGL00990:Slk APN 19 47580252 missense probably damaging 0.98
IGL02283:Slk APN 19 47641993 missense probably damaging 1.00
R0140:Slk UTSW 19 47622335 missense probably damaging 1.00
R0364:Slk UTSW 19 47620189 nonsense probably null
R0944:Slk UTSW 19 47608993 missense probably damaging 1.00
R1756:Slk UTSW 19 47622677 missense probably damaging 0.97
R1795:Slk UTSW 19 47620534 missense possibly damaging 0.72
R1869:Slk UTSW 19 47625452 missense probably damaging 1.00
R1980:Slk UTSW 19 47611989 missense probably damaging 1.00
R2261:Slk UTSW 19 47637352 missense probably damaging 0.99
R2278:Slk UTSW 19 47619749 missense probably damaging 0.97
R3746:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3748:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3749:Slk UTSW 19 47619809 missense possibly damaging 0.88
R4024:Slk UTSW 19 47622370 splice site probably null
R4471:Slk UTSW 19 47615423 missense probably damaging 1.00
R4647:Slk UTSW 19 47620274 missense possibly damaging 0.71
R4825:Slk UTSW 19 47619956 missense probably benign
R5205:Slk UTSW 19 47625460 missense possibly damaging 0.91
R5228:Slk UTSW 19 47625332 missense probably damaging 1.00
R5372:Slk UTSW 19 47625393 missense probably damaging 1.00
R5665:Slk UTSW 19 47636457 missense probably damaging 1.00
R5688:Slk UTSW 19 47620012 missense probably benign 0.00
R5859:Slk UTSW 19 47609042 missense probably benign 0.37
R6279:Slk UTSW 19 47642004 missense probably damaging 1.00
R6368:Slk UTSW 19 47620183 missense possibly damaging 0.85
R6431:Slk UTSW 19 47620888 missense probably damaging 1.00
R6563:Slk UTSW 19 47636469 critical splice donor site probably null
R6705:Slk UTSW 19 47609059 missense probably benign 0.01
R6790:Slk UTSW 19 47635568 missense probably damaging 0.96
R7495:Slk UTSW 19 47638978 missense probably damaging 1.00
R7598:Slk UTSW 19 47636462 missense probably damaging 1.00
R7728:Slk UTSW 19 47620816 missense probably damaging 1.00
R7850:Slk UTSW 19 47622357 missense probably damaging 1.00
R7860:Slk UTSW 19 47642071 missense possibly damaging 0.65
R7911:Slk UTSW 19 47615229 missense
R8000:Slk UTSW 19 47608905 missense
X0052:Slk UTSW 19 47620933 missense probably benign 0.05
Z1176:Slk UTSW 19 47622276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAAATAAACGTGCCTCC -3'
(R):5'- TCCTCTGGTTTCAGACAATCAG -3'

Sequencing Primer
(F):5'- ATAAACGTGCCTCCTCTGAC -3'
(R):5'- CTGGTTTCAGACAATCAGTGTTC -3'
Posted On2015-04-17