Incidental Mutation 'R3889:Adamtsl4'
ID310172
Institutional Source Beutler Lab
Gene Symbol Adamtsl4
Ensembl Gene ENSMUSG00000015850
Gene NameADAMTS-like 4
SynonymsTsrc1
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3889 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95676201-95687917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95680857 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 607 (Q607K)
Ref Sequence ENSEMBL: ENSMUSP00000113424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015994] [ENSMUST00000117782] [ENSMUST00000148854]
Predicted Effect probably damaging
Transcript: ENSMUST00000015994
AA Change: Q607K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015994
Gene: ENSMUSG00000015850
AA Change: Q607K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3.9e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 995 1025 4.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117782
AA Change: Q607K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113424
Gene: ENSMUSG00000015850
AA Change: Q607K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 994 1026 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124410
Predicted Effect probably benign
Transcript: ENSMUST00000148854
SMART Domains Protein: ENSMUSP00000120844
Gene: ENSMUSG00000015850

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:TSP1 51 70 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151054
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ADAMTS superfamily of secreted proteins, which contain a metalloprotease domain at the N-terminus and a C-terminal ancillary domain. ADAMTS-like proteins lack protease activity and resemble the ancillary domain of ADAMTS proteins. ADAMTS-like proteins have been implicated in regulation of the extracellular matrix. The encoded protein contains 7 thrombospondin type 1 repeats, a conserved extracellular domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Adamtsl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Adamtsl4 APN 3 95677533 missense probably benign 0.22
IGL01685:Adamtsl4 APN 3 95684595 missense possibly damaging 0.93
IGL01707:Adamtsl4 APN 3 95683991 missense probably benign 0.39
IGL02105:Adamtsl4 APN 3 95680064 missense probably damaging 1.00
IGL02545:Adamtsl4 APN 3 95683374 nonsense probably null
IGL03089:Adamtsl4 APN 3 95677246 missense probably damaging 1.00
R0099:Adamtsl4 UTSW 3 95684139 missense probably benign 0.00
R0718:Adamtsl4 UTSW 3 95679608 missense possibly damaging 0.49
R0962:Adamtsl4 UTSW 3 95684488 nonsense probably null
R1157:Adamtsl4 UTSW 3 95683661 missense possibly damaging 0.88
R1434:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R1486:Adamtsl4 UTSW 3 95681856 missense probably benign 0.23
R1579:Adamtsl4 UTSW 3 95685497 start gained probably benign
R1703:Adamtsl4 UTSW 3 95677614 missense probably damaging 1.00
R1757:Adamtsl4 UTSW 3 95677942 missense probably benign 0.00
R2018:Adamtsl4 UTSW 3 95681102 missense probably damaging 1.00
R2108:Adamtsl4 UTSW 3 95681047 missense probably damaging 1.00
R4062:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4063:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4124:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4128:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4432:Adamtsl4 UTSW 3 95681759 unclassified probably null
R4433:Adamtsl4 UTSW 3 95681759 unclassified probably null
R4643:Adamtsl4 UTSW 3 95684619 missense possibly damaging 0.90
R4694:Adamtsl4 UTSW 3 95679745 missense probably damaging 1.00
R4719:Adamtsl4 UTSW 3 95679586 critical splice donor site probably null
R4929:Adamtsl4 UTSW 3 95678005 missense probably damaging 1.00
R5044:Adamtsl4 UTSW 3 95681650 critical splice donor site probably null
R5212:Adamtsl4 UTSW 3 95677670 missense probably damaging 1.00
R5234:Adamtsl4 UTSW 3 95680920 missense probably benign 0.00
R5268:Adamtsl4 UTSW 3 95680163 missense probably damaging 0.98
R5473:Adamtsl4 UTSW 3 95679993 missense probably damaging 0.98
R5509:Adamtsl4 UTSW 3 95681357 missense probably benign 0.00
R5566:Adamtsl4 UTSW 3 95685455 critical splice donor site probably null
R5891:Adamtsl4 UTSW 3 95682313 missense possibly damaging 0.95
R5906:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R6224:Adamtsl4 UTSW 3 95681729 missense probably damaging 1.00
R6530:Adamtsl4 UTSW 3 95681054 missense probably benign 0.00
R6861:Adamtsl4 UTSW 3 95680884 missense probably damaging 1.00
R7199:Adamtsl4 UTSW 3 95680809 missense probably benign 0.00
R8083:Adamtsl4 UTSW 3 95684401 missense possibly damaging 0.76
R8251:Adamtsl4 UTSW 3 95684574 missense probably damaging 1.00
X0028:Adamtsl4 UTSW 3 95676964 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGTCCAGGATACAGAATCTG -3'
(R):5'- GAGAGTCCTTCCACAAAGCCTC -3'

Sequencing Primer
(F):5'- GATGCTGAACACTCAGAG -3'
(R):5'- TTCAGCCTCAGCCTGGTAAAACTAG -3'
Posted On2015-04-17