Mutagenetix > Incidental Mutation

Incidental Mutation 'R3889:Atp6v0a2'

310180

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

040801-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R3889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124639265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 168 (R168Q)

Ref Sequence

ENSEMBL: ENSMUSP00000143284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: R168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: R168Q

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197931

Predicted Effect

probably damaging
Transcript: ENSMUST00000198382
AA Change: R168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023
AA Change: R168Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200292

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
7530416G11Rik	A	G	15: 85,494,091	F117S	unknown	Het
Adamts5	A	G	16: 85,868,121	W652R	probably damaging	Het
Adamtsl4	G	T	3: 95,680,857	Q607K	probably damaging	Het
Atm	T	C	9: 53,506,636		probably benign	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Baiap2l1	T	C	5: 144,278,535	T387A	possibly damaging	Het
Cct3	A	T	3: 88,321,027	Q472L	probably benign	Het
Chd3	C	T	11: 69,359,185	E623K	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dclre1a	A	T	19: 56,545,320	C263S	probably benign	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Eif2ak1	A	T	5: 143,884,661	Q265L	probably benign	Het
Epha3	A	G	16: 63,610,964	F526L	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fat2	C	A	11: 55,281,763	G2708V	probably damaging	Het
Fgd6	G	A	10: 94,089,637	E853K	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Fsd1	A	G	17: 55,993,893	K251E	probably benign	Het
Gjc3	T	A	5: 137,957,843	N60I	possibly damaging	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
H6pd	T	A	4: 149,995,773	Y197F	possibly damaging	Het
Hip1r	C	T	5: 124,001,791	R986*	probably null	Het
Igkv9-120	A	G	6: 68,050,378	D92G	probably damaging	Het
Ikbkap	G	A	4: 56,759,852	R1138C	probably damaging	Het
Il6	A	G	5: 30,018,068	K128E	possibly damaging	Het
Irf4	T	C	13: 30,761,490		probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Ltbp2	A	G	12: 84,784,907		probably benign	Het
Pcmt1	C	T	10: 7,649,050		probably null	Het
Plekhm2	C	T	4: 141,641,990		probably benign	Het
Prkca	C	T	11: 107,979,240	G450R	probably damaging	Het
Psme3	C	A	11: 101,319,456	P82T	probably damaging	Het
Rgs11	T	C	17: 26,207,587	I262T	probably damaging	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Serpina1e	A	T	12: 103,950,873	V179E	probably damaging	Het
Sgo2b	T	C	8: 63,927,743	Q685R	possibly damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slc25a45	C	T	19: 5,880,633		probably benign	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Spen	A	G	4: 141,477,881	V1145A	unknown	Het
Stub1	T	C	17: 25,831,302		probably benign	Het
Taar8a	A	G	10: 24,077,025	I176V	probably benign	Het
Tacr2	G	A	10: 62,265,086	C325Y	probably damaging	Het
Tbc1d17	T	A	7: 44,845,938	H154L	probably damaging	Het
Tll1	A	T	8: 64,205,224	C54S	possibly damaging	Het
Tpsb2	G	A	17: 25,367,483	V181I	probably damaging	Het
Trak1	A	G	9: 121,445,873	N146S	probably null	Het
Vmn1r177	T	C	7: 23,865,864	I196V	possibly damaging	Het
Zfp820	T	C	17: 21,818,896	I484V	probably benign	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCTGTTCACCTGTCAGG -3'
(R):5'- AGAGGTCCCTTCGGCTTTTAG -3'

Sequencing Primer
(F):5'- GTTCACCTGTCAGGCTTGGC -3'
(R):5'- GCTACATCAATGCTGCATGACTAAG -3'

Posted On

2015-04-17