Mutagenetix > Incidental Mutation

Incidental Mutation 'R3889:Tll1'

310190

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

MMRRC Submission

040801-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64205224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 54 (C54S)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166] [ENSMUST00000210256]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066166
AA Change: C54S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: C54S

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209451

Predicted Effect

probably benign
Transcript: ENSMUST00000210256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211755

Meta Mutation Damage Score

0.5798

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
7530416G11Rik	A	G	15: 85,494,091	F117S	unknown	Het
Adamts5	A	G	16: 85,868,121	W652R	probably damaging	Het
Adamtsl4	G	T	3: 95,680,857	Q607K	probably damaging	Het
Atm	T	C	9: 53,506,636		probably benign	Het
Atp6v0a2	G	A	5: 124,639,265	R168Q	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Baiap2l1	T	C	5: 144,278,535	T387A	possibly damaging	Het
Cct3	A	T	3: 88,321,027	Q472L	probably benign	Het
Chd3	C	T	11: 69,359,185	E623K	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dclre1a	A	T	19: 56,545,320	C263S	probably benign	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Eif2ak1	A	T	5: 143,884,661	Q265L	probably benign	Het
Epha3	A	G	16: 63,610,964	F526L	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fat2	C	A	11: 55,281,763	G2708V	probably damaging	Het
Fgd6	G	A	10: 94,089,637	E853K	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Fsd1	A	G	17: 55,993,893	K251E	probably benign	Het
Gjc3	T	A	5: 137,957,843	N60I	possibly damaging	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
H6pd	T	A	4: 149,995,773	Y197F	possibly damaging	Het
Hip1r	C	T	5: 124,001,791	R986*	probably null	Het
Igkv9-120	A	G	6: 68,050,378	D92G	probably damaging	Het
Ikbkap	G	A	4: 56,759,852	R1138C	probably damaging	Het
Il6	A	G	5: 30,018,068	K128E	possibly damaging	Het
Irf4	T	C	13: 30,761,490		probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Ltbp2	A	G	12: 84,784,907		probably benign	Het
Pcmt1	C	T	10: 7,649,050		probably null	Het
Plekhm2	C	T	4: 141,641,990		probably benign	Het
Prkca	C	T	11: 107,979,240	G450R	probably damaging	Het
Psme3	C	A	11: 101,319,456	P82T	probably damaging	Het
Rgs11	T	C	17: 26,207,587	I262T	probably damaging	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Serpina1e	A	T	12: 103,950,873	V179E	probably damaging	Het
Sgo2b	T	C	8: 63,927,743	Q685R	possibly damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slc25a45	C	T	19: 5,880,633		probably benign	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Spen	A	G	4: 141,477,881	V1145A	unknown	Het
Stub1	T	C	17: 25,831,302		probably benign	Het
Taar8a	A	G	10: 24,077,025	I176V	probably benign	Het
Tacr2	G	A	10: 62,265,086	C325Y	probably damaging	Het
Tbc1d17	T	A	7: 44,845,938	H154L	probably damaging	Het
Tpsb2	G	A	17: 25,367,483	V181I	probably damaging	Het
Trak1	A	G	9: 121,445,873	N146S	probably null	Het
Vmn1r177	T	C	7: 23,865,864	I196V	possibly damaging	Het
Zfp820	T	C	17: 21,818,896	I484V	probably benign	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64101950	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64085473	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6083:Tll1	UTSW	8	64038586	splice site	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64025142	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64098234	splice site	probably null
R7687:Tll1	UTSW	8	64121492	nonsense	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64124906	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64085465	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64016167	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64016089	missense	probably damaging	1.00
R9539:Tll1	UTSW	8	64041423	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACTCCAGGGAACTTGGG -3'
(R):5'- GGATAAGAACACTGTCCCTAGAGC -3'

Sequencing Primer
(F):5'- AGGGAACTTGGGCCGCC -3'
(R):5'- GTCCCTAGAGCCCCGCATATC -3'

Posted On

2015-04-17