Incidental Mutation 'R3889:Pcmt1'
ID310194
Institutional Source Beutler Lab
Gene Symbol Pcmt1
Ensembl Gene ENSMUSG00000019795
Gene Nameprotein-L-isoaspartate (D-aspartate) O-methyltransferase 1
SynonymsPIMT, protein carboxyl methyltransferase
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R3889 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7629373-7681136 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 7649050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159917] [ENSMUST00000159977] [ENSMUST00000159977] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000162682] [ENSMUST00000162682] [ENSMUST00000163085]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159835
Predicted Effect probably null
Transcript: ENSMUST00000159917
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159977
Predicted Effect probably null
Transcript: ENSMUST00000159977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160517
Predicted Effect probably benign
Transcript: ENSMUST00000161123
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161428
SMART Domains Protein: ENSMUSP00000123758
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 160 2.7e-61 PFAM
Pfam:Ubie_methyltran 49 148 8.3e-7 PFAM
Pfam:Methyltransf_31 58 111 3.9e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162606
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163085
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene causes accumulation of modified proteins, growth retardation and fatal epileptic seizures. Homozygotes for one null allele also show a small spleen, altered lipid, hormone, mineral and enzyme profiles, kyphosis, enlarged brain and abnormal dendritic arborizations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Pcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02934:Pcmt1 APN 10 7640727 missense probably benign 0.00
R1968:Pcmt1 UTSW 10 7640710 nonsense probably null
R5454:Pcmt1 UTSW 10 7640745 missense probably damaging 1.00
R5630:Pcmt1 UTSW 10 7649093 missense probably damaging 1.00
R5705:Pcmt1 UTSW 10 7638190 missense possibly damaging 0.86
R6667:Pcmt1 UTSW 10 7663149 missense probably damaging 1.00
R7163:Pcmt1 UTSW 10 7638158 missense probably benign 0.01
R7168:Pcmt1 UTSW 10 7638182 missense probably damaging 1.00
R7531:Pcmt1 UTSW 10 7680605 intron probably null
R8012:Pcmt1 UTSW 10 7640763 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCACTCAGCTACAACTCTTAAATTTCC -3'
(R):5'- CATTGCCTGGATCATGGCAG -3'

Sequencing Primer
(F):5'- TGCTACAAGGGGTAGGTT -3'
(R):5'- TGGATCATGGCAGGCAGC -3'
Posted On2015-04-17