Mutagenetix > Incidental Mutations

Incidental Mutation 'R3889:Fgd6'

310197

Institutional Source

Beutler Lab

Gene Symbol

Fgd6

Ensembl Gene

ENSMUSG00000020021

Gene Name

FYVE, RhoGEF and PH domain containing 6

Synonyms

Etohd4, ZFYVE24

MMRRC Submission

040801-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.502) question?

Stock #

R3889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94036001-94145339 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 94089637 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 853 (E853K)

Ref Sequence

ENSEMBL: ENSMUSP00000020208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020208]

PDB Structure

Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020208
AA Change: E853K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: E853K

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	24	34	N/A	INTRINSIC
low complexity region	45	60	N/A	INTRINSIC
low complexity region	75	88	N/A	INTRINSIC
low complexity region	150	161	N/A	INTRINSIC
low complexity region	403	418	N/A	INTRINSIC
low complexity region	803	821	N/A	INTRINSIC
RhoGEF	845	1029	3.09e-46	SMART
PH	1060	1155	6.25e-15	SMART
FYVE	1183	1251	6.93e-28	SMART
low complexity region	1268	1282	N/A	INTRINSIC
PH	1303	1398	1.54e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141143

Meta Mutation Damage Score

0.9410

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

94% (51/54)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
7530416G11Rik	A	G	15: 85,494,091	F117S	unknown	Het
Adamts5	A	G	16: 85,868,121	W652R	probably damaging	Het
Adamtsl4	G	T	3: 95,680,857	Q607K	probably damaging	Het
Atm	T	C	9: 53,506,636		probably benign	Het
Atp6v0a2	G	A	5: 124,639,265	R168Q	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Baiap2l1	T	C	5: 144,278,535	T387A	possibly damaging	Het
Cct3	A	T	3: 88,321,027	Q472L	probably benign	Het
Chd3	C	T	11: 69,359,185	E623K	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dclre1a	A	T	19: 56,545,320	C263S	probably benign	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Eif2ak1	A	T	5: 143,884,661	Q265L	probably benign	Het
Epha3	A	G	16: 63,610,964	F526L	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fat2	C	A	11: 55,281,763	G2708V	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Fsd1	A	G	17: 55,993,893	K251E	probably benign	Het
Gjc3	T	A	5: 137,957,843	N60I	possibly damaging	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
H6pd	T	A	4: 149,995,773	Y197F	possibly damaging	Het
Hip1r	C	T	5: 124,001,791	R986*	probably null	Het
Igkv9-120	A	G	6: 68,050,378	D92G	probably damaging	Het
Ikbkap	G	A	4: 56,759,852	R1138C	probably damaging	Het
Il6	A	G	5: 30,018,068	K128E	possibly damaging	Het
Irf4	T	C	13: 30,761,490		probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Ltbp2	A	G	12: 84,784,907		probably benign	Het
Pcmt1	C	T	10: 7,649,050		probably null	Het
Plekhm2	C	T	4: 141,641,990		probably benign	Het
Prkca	C	T	11: 107,979,240	G450R	probably damaging	Het
Psme3	C	A	11: 101,319,456	P82T	probably damaging	Het
Rgs11	T	C	17: 26,207,587	I262T	probably damaging	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Serpina1e	A	T	12: 103,950,873	V179E	probably damaging	Het
Sgo2b	T	C	8: 63,927,743	Q685R	possibly damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slc25a45	C	T	19: 5,880,633		probably benign	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Spen	A	G	4: 141,477,881	V1145A	unknown	Het
Stub1	T	C	17: 25,831,302		probably benign	Het
Taar8a	A	G	10: 24,077,025	I176V	probably benign	Het
Tacr2	G	A	10: 62,265,086	C325Y	probably damaging	Het
Tbc1d17	T	A	7: 44,845,938	H154L	probably damaging	Het
Tll1	A	T	8: 64,205,224	C54S	possibly damaging	Het
Tpsb2	G	A	17: 25,367,483	V181I	probably damaging	Het
Trak1	A	G	9: 121,445,873	N146S	probably null	Het
Vmn1r177	T	C	7: 23,865,864	I196V	possibly damaging	Het
Zfp820	T	C	17: 21,818,896	I484V	probably benign	Het

Other mutations in Fgd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Fgd6	APN	10	94043634	missense	probably benign	0.01
IGL00975:Fgd6	APN	10	94134076	missense	probably damaging	0.98
IGL01366:Fgd6	APN	10	94043476	missense	possibly damaging	0.71
IGL01940:Fgd6	APN	10	94089650	splice site	probably null
IGL01958:Fgd6	APN	10	94138308	missense	probably benign	0.25
IGL01988:Fgd6	APN	10	94074335	splice site	probably benign
IGL02019:Fgd6	APN	10	94133354	missense	probably damaging	1.00
IGL02074:Fgd6	APN	10	94127435	missense	probably damaging	1.00
IGL02227:Fgd6	APN	10	94134084	missense	probably damaging	1.00
IGL02262:Fgd6	APN	10	94125628	missense	probably damaging	0.98
IGL02353:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02360:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02425:Fgd6	APN	10	94074202	missense	probably benign	0.00
IGL02526:Fgd6	APN	10	94100511	missense	probably benign	0.21
IGL02607:Fgd6	APN	10	94044448	missense	possibly damaging	0.94
IGL02741:Fgd6	APN	10	94123290	missense	possibly damaging	0.65
IGL02870:Fgd6	APN	10	94045164	missense	probably damaging	1.00
IGL02884:Fgd6	APN	10	94045639	splice site	probably benign
IGL02995:Fgd6	APN	10	94045480	nonsense	probably null
IGL03189:Fgd6	APN	10	94044456	missense	probably benign	0.26
IGL03258:Fgd6	APN	10	94133353	missense	probably benign	0.44
IGL03396:Fgd6	APN	10	94044456	missense	probably benign	0.26
FR4449:Fgd6	UTSW	10	94044320	small deletion	probably benign
R0257:Fgd6	UTSW	10	94043915	missense	probably benign	0.11
R0926:Fgd6	UTSW	10	94135047	missense	probably benign	0.40
R1325:Fgd6	UTSW	10	94127427	missense	probably damaging	1.00
R1422:Fgd6	UTSW	10	94045372	missense	probably damaging	1.00
R1491:Fgd6	UTSW	10	94044832	missense	probably benign	0.06
R1593:Fgd6	UTSW	10	94045032	missense	probably damaging	1.00
R1624:Fgd6	UTSW	10	94137436	missense	probably benign	0.19
R1929:Fgd6	UTSW	10	94045006	missense	probably benign	0.01
R2064:Fgd6	UTSW	10	94045041	missense	probably damaging	0.98
R2965:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R2966:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R4094:Fgd6	UTSW	10	94043434	missense	probably damaging	1.00
R4605:Fgd6	UTSW	10	94044355	missense	probably benign	0.12
R4883:Fgd6	UTSW	10	94139853	missense	probably benign	0.00
R5217:Fgd6	UTSW	10	94134077	missense	possibly damaging	0.90
R5473:Fgd6	UTSW	10	94044676	missense	probably benign	0.00
R5606:Fgd6	UTSW	10	94138328	nonsense	probably null
R5644:Fgd6	UTSW	10	94134050	missense	possibly damaging	0.80
R6051:Fgd6	UTSW	10	94137565	critical splice donor site	probably null
R6258:Fgd6	UTSW	10	94044299	missense	probably benign	0.00
R6735:Fgd6	UTSW	10	94074320	missense	possibly damaging	0.94
R7181:Fgd6	UTSW	10	94043511	missense	probably benign	0.02
R7210:Fgd6	UTSW	10	94134092	missense	probably damaging	0.98
R7296:Fgd6	UTSW	10	94044047	nonsense	probably null
R7296:Fgd6	UTSW	10	94139881	missense	probably benign	0.02
R7697:Fgd6	UTSW	10	94045444	missense	probably damaging	0.99
R7747:Fgd6	UTSW	10	94044916	missense	probably damaging	1.00
R7861:Fgd6	UTSW	10	94103331	missense	probably benign	0.15
R7940:Fgd6	UTSW	10	94120482	missense	probably benign	0.02
R8022:Fgd6	UTSW	10	94044344	missense	possibly damaging	0.54
R8138:Fgd6	UTSW	10	94134143	missense	probably null	0.45
R8171:Fgd6	UTSW	10	94074332	critical splice donor site	probably null
R8189:Fgd6	UTSW	10	94074215	missense	probably benign	0.00
R8213:Fgd6	UTSW	10	94044052	missense	probably benign	0.37
RF031:Fgd6	UTSW	10	94044325	frame shift	probably null
RF040:Fgd6	UTSW	10	94044325	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGTGAATCGTGTGCTAATAAGG -3'
(R):5'- AGCGCGTGTGTATTGCTCAC -3'

Sequencing Primer
(F):5'- ATCGTGTGCTAATAAGGATGGG -3'
(R):5'- GCTCACTTGTTAGCTATGCTGAGAAC -3'

Posted On

2015-04-17