Incidental Mutation 'R3889:Rgs11'
ID310214
Institutional Source Beutler Lab
Gene Symbol Rgs11
Ensembl Gene ENSMUSG00000024186
Gene Nameregulator of G-protein signaling 11
Synonyms
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R3889 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26202951-26211324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26207587 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 262 (I262T)
Ref Sequence ENSEMBL: ENSMUSP00000113885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025020] [ENSMUST00000114988] [ENSMUST00000122058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025020
AA Change: I264T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186
AA Change: I264T

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114988
SMART Domains Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122058
AA Change: I262T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186
AA Change: I262T

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Rgs11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Rgs11 APN 17 26207397 missense probably damaging 1.00
IGL01617:Rgs11 APN 17 26208250 missense probably damaging 1.00
IGL02150:Rgs11 APN 17 26202994 missense probably benign 0.05
IGL02610:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02612:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02617:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02669:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02670:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02674:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02706:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02707:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02741:Rgs11 APN 17 26207631 missense probably benign 0.31
R0147:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0148:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0508:Rgs11 UTSW 17 26207469 splice site probably benign
R0744:Rgs11 UTSW 17 26203318 missense probably damaging 1.00
R1479:Rgs11 UTSW 17 26208283 unclassified probably null
R1599:Rgs11 UTSW 17 26208249 missense probably damaging 1.00
R1779:Rgs11 UTSW 17 26210666 missense probably damaging 1.00
R3692:Rgs11 UTSW 17 26204328 unclassified probably benign
R3807:Rgs11 UTSW 17 26203500 missense probably damaging 0.99
R4689:Rgs11 UTSW 17 26204547 critical splice donor site probably null
R4832:Rgs11 UTSW 17 26207568 missense probably benign 0.00
R5052:Rgs11 UTSW 17 26207973 intron probably benign
R5330:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5331:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5683:Rgs11 UTSW 17 26205181 missense probably benign 0.32
R5879:Rgs11 UTSW 17 26203463 unclassified probably benign
R6156:Rgs11 UTSW 17 26210465 nonsense probably null
R6671:Rgs11 UTSW 17 26208298 missense probably damaging 1.00
R7432:Rgs11 UTSW 17 26207760 missense probably damaging 0.99
R7609:Rgs11 UTSW 17 26207441 missense probably damaging 1.00
R7795:Rgs11 UTSW 17 26207578 missense possibly damaging 0.88
R7820:Rgs11 UTSW 17 26205195 splice site probably null
R8025:Rgs11 UTSW 17 26204385 critical splice donor site probably null
Z1088:Rgs11 UTSW 17 26205772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCCTAGATCGAGTGCTTCAG -3'
(R):5'- CTCAACGCGGAGTTTTGTG -3'

Sequencing Primer
(F):5'- TGCTTCAGGAAGGCACTG -3'
(R):5'- TTTGTGGGGGCAGCCAC -3'
Posted On2015-04-17